HTLV-1 viral oncogene HBZ drives bone destruction in adult T cell leukemia

Xiang, Jingyu; Rauch, Daniel A.; Huey, Devra; Panfil, Amanda R.; Cheng, Xiaogang; Esser, Alison K.; Su, Xinming; Harding, John C. S.; Xu, Yalin; Fox, Gregory C.; Fontana, Francesca; Kobayashi, Takayuki; Su, Junjing; Sundaramoorthi, Hemalatha; Wong, Winghing; Jia, Yizhen; Rosol, Thomas J.; Veis, Deborah J.; Green, Patrick L.; Niewiesk, Stefan; Ratner, Lee; Weilbaecher, Katherine N.

doi:10.1172/jci.insight.128713

Cited by 16 publications

(17 citation statements)

References 67 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Yet, no evidence was observed in any of these hbz transgenics pertaining to NF-κB activation, a hallmark of ATL [ 59 , 60 ]. Recently, a humanized mouse model infected with HTLV-1 lacking functional HBZ showed a similar lymphoproliferative disease with no survival difference compared to wild type HTLV-1, suggesting that HBZ is not essential for tumor development in vivo [ 61 ]. Ideally, these mice models are potentially more relevant than flies to study the biology of HTLV-1, known to infect primates.…”

Section: Discussionmentioning

confidence: 99%

In vivo antagonistic role of the Human T-Cell Leukemia Virus Type 1 regulatory proteins Tax and HBZ

et al. 2021

View full text Add to dashboard Cite

Adult T cell leukemia (ATL) is an aggressive malignancy secondary to chronic infection by the human T-cell leukemia virus type 1 (HTLV-1) infection. Two viral proteins, Tax and HBZ, play central roles in ATL leukemogenesis. Tax expression transforms T cells in vitro and induces ATL-like disease in mice. Tax also induces a rough eye phenotype and increases hemocyte count in Drosophila melanogaster, indicative of transformation. Among multiple functions, Tax modulates the expression of the enhancer of zeste homolog 2 (EZH2), a methyltransferase of the Polycomb Repressive Complex 2 (PRC2), leading to H3K27me3-dependent reprogramming of around half of cellular genes. HBZ is a negative regulator of Tax-mediated viral transcription. HBZ effects on epigenetic signatures are underexplored. Here, we established an hbz transgenic fly model, and demonstrated that, unlike Tax, which induces NF-κB activation and enhanced PRC2 activity creating an activation loop, HBZ neither induces transformation nor NF-κB activation in vivo. However, overexpression of Tax or HBZ increases the PRC2 activity and both proteins directly interact with PRC2 complex core components. Importantly, overexpression of HBZ in tax transgenic flies prevents Tax-induced NF-κB or PRC2 activation and totally rescues Tax-induced transformation and senescence. Our results establish the in vivo antagonistic effect of HBZ on Tax-induced transformation and cellular effects. This study helps understanding long-term HTLV-1 persistence and cellular transformation and opens perspectives for new therapeutic strategies targeting the epigenetic machinery in ATL.

show abstract

Section: Discussionmentioning

confidence: 99%

In vivo antagonistic role of the Human T-Cell Leukemia Virus Type 1 regulatory proteins Tax and HBZ

et al. 2021

View full text Add to dashboard Cite

show abstract

“…RNA was extracted from cells using an RNeasy kit (Qiagen), and cDNA was generated with qScript cDNA supermix (Quanta Bio). qPCR was performed with PerfeCTa SYBR green supermix reagent (Quanta Bio) on the Bio-Rad CFX96 machine, as previously described ( 57 ). Primers designed for qPCR are as follows: HPSE forward primer 5′- CTCTCTGCTCTGCCATCTTTAG -3′ and reverse primer 5′- CCTCTGGTTGCTATGAGGTTT -3′, IL6 forward primer 5′- CTTCCATCCAGTTGCCTTCT -3′ and reverse primer 5′- CTCCGACTTGTGAAGTGGTATAG -3′, TNF forward primer 5′- CCAGGGACCTCTCTCTAATCA -3′ and reverse primer 5′- TCAGCTTGAGGGTTTGCTAC -3′, CCL2 forward primer 5′- TCATAGCAGCCACCTTCATTC -3′ and reverse primer 5′- CTCTGCACTGAGATCTTCCTATTG -3′, IFNG forward primer 5′- ATGTCCAACGCAAAGCAATAC -3′ and reverse primer 5′- ACCTCGAAACAGCATCTGAC -3′, HPRT forward primer 5′- AGAATGTCTTGATTGTGGAAGA -3′ and reverse primer 5′- ACCTTGACCATCTTTGGATTA -3′, IL1B forward primer 5′- CAAAGGCGGCCAGGATATAA -3′ and reverse primer 5′- CTAGGGATTGAGTCCACATTCAG -3′, and GAPDH forward primer 5′- AGGTCGGTGTGAACGGATTTG -3′ and reverse primer 5′- TGTAGACCATGTAGTTGAGGTCA -3′.…”

Section: Methodsmentioning

confidence: 99%

Heparanase Blockade as a Novel Dual-Targeting Therapy for COVID-19

Xiang

Shi

et al. 2022

J Virol

Self Cite

View full text Add to dashboard Cite

show abstract

“…Taking advantage of humanized mice, the role of HBZ in altering the expression of the receptor activator of NF-κB ligand (RANKL), a regulator of osteoclast differentiation, was evaluated in vivo. In this HTLV-1-infected humanized mouse model, treatment with denosumab, a monoclonal antibody against human RANKL, resulted in reduced bone loss [ 177 ].…”

Section: Animal Modelsmentioning

confidence: 99%

HTLV-1 Infection and Pathogenesis: New Insights from Cellular and Animal Models

Forlani

Shallak

Accolla

et al. 2021

IJMS

View full text Add to dashboard Cite

Since the discovery of the human T-cell leukemia virus-1 (HTLV-1), cellular and animal models have provided invaluable contributions in the knowledge of viral infection, transmission and progression of HTLV-associated diseases. HTLV-1 is the causative agent of the aggressive adult T-cell leukemia/lymphoma and inflammatory diseases such as the HTLV-1 associated myelopathy/tropical spastic paraparesis (HAM/TSP). Cell models contribute to defining the role of HTLV proteins, as well as the mechanisms of cell-to-cell transmission of the virus. Otherwise, selected and engineered animal models are currently applied to recapitulate in vivo the HTLV-1 associated pathogenesis and to verify the effectiveness of viral therapy and host immune response. Here we review the current cell models for studying virus–host interaction, cellular restriction factors and cell pathway deregulation mediated by HTLV products. We recapitulate the most effective animal models applied to investigate the pathogenesis of HTLV-1-associated diseases such as transgenic and humanized mice, rabbit and monkey models. Finally, we summarize the studies on STLV and BLV, two closely related HTLV-1 viruses in animals. The most recent anticancer and HAM/TSP therapies are also discussed in view of the most reliable experimental models that may accelerate the translation from the experimental findings to effective therapies in infected patients.

show abstract

HTLV-1 viral oncogene HBZ drives bone destruction in adult T cell leukemia

Cited by 16 publications

References 67 publications

In vivo antagonistic role of the Human T-Cell Leukemia Virus Type 1 regulatory proteins Tax and HBZ

In vivo antagonistic role of the Human T-Cell Leukemia Virus Type 1 regulatory proteins Tax and HBZ

Heparanase Blockade as a Novel Dual-Targeting Therapy for COVID-19

HTLV-1 Infection and Pathogenesis: New Insights from Cellular and Animal Models

Contact Info

Product

Resources

About