Human Ca2+/Calmodulin-dependent Protein Kinase Kinase β Gene Encodes Multiple Isoforms That Display Distinct Kinase Activity

Abstract

Ca؉2 /calmodulin-dependent protein kinases (CaMKs) are activated upon binding of Ca ؉2 /calmodulin. To gain maximal activity, CaMK I and CaMK IV can be further phosphorylated by an upstream kinase, CaMK kinase (CaMKK). We previously isolated cDNA clones encoding human CaMKK ␤ isoforms that are heterogeneous in their 3-sequences (Hsu, L.-S., Tsou, A.-P., Chi, C.-W., Lee, C.-H., and Chen, J.-Y. (1998) J. Biomed. Sci. 5, 141-149). In the present study, we examined the genomic organization and transcription of the human CaMKK ␤ gene. The human CaMKK ␤ locus spans more than 40 kilobase pairs and maps to chromosome 12q24.2. It is organized into 18 exons and 17 introns that are flanked by typical splice donor and acceptor sequences. Two major species of transcripts, namely the ␤1 (5.6 kilobase pairs) and ␤2 (2.9 kilobase pairs), are generated through differential usage of polyadenylation sites located in the last and penultimate exons. Additional forms of CaMKK ␤ transcripts were also identified that resulted from alternative splicing of the internal exons 14 and/or 16. These isoforms display differential expression patterns in human tissues and tumor-derived cell lines. They also exhibit a distinct ability to undergo autophosphorylation and to phosphorylate the downstream kinases CaMK I and CaMK IV. The differential expression of CaMKK ␤ isoforms with distinct activity further suggests the complexity of the regulation of the CaMKK/CaMK cascade and an important role for CaMKK in the action of Ca ؉2 -mediated cellular responses.

Calcium/Calmodulin-Dependent Kinase I and Calcium/Calmodulin-Dependent Kinase Kinase Participate in the Control of Cell Cycle Progression in MCF-7 Human Breast Cancer Cells

“…It may represent a spliced variant or a yet to be identified isoform. It is known that CaM-KK is alternatively spliced (11). The CaMKKh2 isoform was not expressed at readily detectable levels in the MCF-7 cells.…”

“…One microgram of total RNA per reaction was DNase I treated and converted to cDNA, which was used as a template for PCR. Thirty cycles (95jC for 1 minute, 51jC for 1 minute, and 72jC for 1 minute) were done with the following primers: for CaM-KKa sense primer, ACTCACTTGGAGGAGGCAGA and antisense primer, GCTGGGAG-CAGTCTTGAAGT; for CaM-KKh, we used primers previously described (11). Reverse transcription-PCR (RT-PCR) reactions were done using ReadyTo-Go RT-PCR Beads from Amersham Biosciences Co. (Piscataway, NJ).…”

“…CaM-KII is clearly the best characterized of the multifunctional CaM-Ks and is expressed in a variety of tissues (10). Multiple isoforms of CaM-KK and CaM-KII are reported to exist (11,12).…”

The Ca2+/Calmodulin-dependent Protein Kinase Kinases Are AMP-activated Protein Kinase Kinases

“…The CaMKK␤ gene encodes several isoforms generated through differential usage of polyadenylation sites and/or as a result of alternative splicing of the internal exons 14 and/or 16 (21,25), although the characteristics of the protein products (gel mobility, kinase activity, and tissue distribution) have not been fully delineated. In HeLa cells, the ␤1 and ␤2 isoforms are absent; mRNAs encoding two novel CaMKK isoforms (CaMKK␤3 and CaMKK␤3x) generated through alternative splicing have been noted (21).…”

Using the fluorescent properties of STO-609 as a tool to assist structure-function analyses of recombinant CaMKK2

“…This also confirmed the robustness and reproducibility of our assay. CaMKK2 is also expressed as a number of isoforms which each have their own regulatory characteristics -differing in their phosphorylation profiles and responses to CaM binding [3,20]. In this study we have expressed and purified isoform 3 which, whilst binding to calmodulin, does not…”