Human glutathione S-transferase mu (GSTμ) deficiency as a marker for the susceptibility to bladder and larynx cancer among smokers and malignant melanoma

Lafuente, Amàlia; Carretero, P; Cuchí, A; Alonso, M M; Hernandez, Ma Rosa; Lafuente, Marta; Castel, Teresa; Moral, Antonio

doi:10.1016/s0378-4274(96)80333-x

Cited by 14 publications

(23 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Our results on GSTM1 null genotype in healthy controls were in agreement with previous studies reported from other ethnic groups. In addition to this, GSTM1 null genotype was associated with high risk for developing lung, bladder, gastric, colorectal cancer [14][15][16] whereas other data were presented that there was no contribution of the GSTM1 null genotype for cancer development [17][18][19][20][21]. There are studies in order to determine the relation between GST genotypes and development of laryngeal cancer.…”

Section: Discussionmentioning

confidence: 99%

Relationship of tobacco smoking with GSTM1 gene polymorphism in laringeal cancer

Bardakçı

Canbay

Değerli

et al. 2003

J Cellular Molecular Medi

View full text Add to dashboard Cite

This paper aimed to analyze the association of polymorphism of GSTM1 0/0 genotype with laryngeal cancer along a hospital based case‐control study. Polymorphisms of GSTM1 0/0 of samples from 36 patients with laryngeal cancer and 35 healthy controls were detected by PCR method. The reaction used as GSTM1 primers, using the sequence sense: 5′‐CTGCCCTACTTGGATTGATGGG‐3′ and antisense: 5′‐TGGATTGTAGCAGATCATGC‐3′. N Acetyl transferase 1 (NAT1) gene using the primers sense: 5′‐TAAAAGTAAAATGATTTGCTTTCG‐3′ and antisense: 5′‐GCTTTCTAGCATAAATCACCAA‐3′ was used as internal positive control. Two sided 2 and multivariation analysis were used to analyse the results. The proportions of GSTM1 deleted genotype in cases and controls were 47.2% and 54.3%, respectively. There was significant increment of GSTM 0/0 genotype frequency in moderate smokers group of patients compared to control (P=0.033, OR= 4.78, 95% CI=1.30‐7.13). We conclude that GSTM1 deleted genotype may be a genetic susceptibility marker for laryngeal cancer whose exposed to low doses carcinogens. The absence of this enzyme seems to have a role in the development of laryngeal cancer, in which the mechanism still needs further investigation.

show abstract

Section: Discussionmentioning

confidence: 99%

Relationship of tobacco smoking with GSTM1 gene polymorphism in laringeal cancer

Bardakçı

Canbay

Değerli

et al. 2003

J Cellular Molecular Medi

View full text Add to dashboard Cite

show abstract

“…Interindividual variation in GST genotype has been related to differences in the occurrence of a number of human malignancies. [23][24][25][26][27][28][29][30] …”

Section: Introductionmentioning

confidence: 99%

Glutathione S-transferase genotypes in children who develop treatment-related acute myeloid malignancies

et al. 2000

View full text Add to dashboard Cite

Epipodophyllotoxin-associated secondary myeloid leukemia is a devastating complication of acute lymphoblastic leukemia (ALL) therapy. The risk factors for treatment-related myeloid leukemia remain incompletely defined. Genetic deficiencies in glutathione S-transferase (GST) activities have been linked to higher frequencies of a number of human malignancies. Our objective was to determine whether the null genotype for GSTM1, GSTT1, or both, was more frequent in children with ALL who developed treatment-related myeloid malignancies as compared to those who did not. A PCR technique was used to assay for the null genotype for GSTM1 and GSTT1 in 302 children with ALL, 57 of whom also subsequently developed treatment-related acute myeloid leukemia or myelodysplastic syndrome. Among children with ALL who did not develop treatment-related myeloid malignancies, the frequencies of GSTM1 and GSTT1 wild-type, GSTM1 null-GSTT1 wild-type, GSTM1 wild-type-GSTT1 null, and GSTM1 and GSTT1 null genotypes were 40%, 42%, 9% and 9%, respectively. The corresponding frequencies for patients who developed acute myeloid malignancies were 42%, 32%, 11% and 16%, respectively (P = 0.26). A statistically significant increase in the frequency of the GST null genotype was observed in male patients who developed myeloid malignancies as compared to male ALL control patients (P = 0.036), but was not observed in female patients (P = 0.51). Moreover, a logistic regression analysis of possible predictors for myeloid malignancies, controlling for gender and race, did not reveal an association of GSTM1 or GSTT1 null genotypes (P = 0.62 and 0.11, respectively) with treatment-related malignancies. Our data suggest that GSTM1 and GSTT1 null genotypes may not predispose to epipodophyllotoxin-associated myeloid malignancies. Leukemia (2000) 14, 232-237.

show abstract

“…Our results suggest that tobacco smoking may also increase the risk of this malignancy in GSTM1-negative schistosomiasis patients. An effect of smoking on the GSTM1 deficiency-associated risk of cancer has been described in relation to other squamous cell carcinomas such as SCC of lung (Hayashi, 1992) and other tobacco-dependent neoplasms such as TCC of the bladder (Lafuente et al, 1993;Bell et al, 1993) (Table I). The coincidence of parasitic genotoxins, tobacco toxicants, greater age (as a non-specific factor) and an increase in oxidative capacity caused by schistosomiasis may favour the development of the neoplasm.…”

Section: Discussionmentioning

confidence: 99%

“…Indeed, a greater susceptibility to lung (Seidegard et al, 1990) and larynx cancer (Lafuente et al, 1933) has been shown among smokers lacking GSTM1. Susceptibility to bladder cancer has also been studied, although only transitional cell carcinoma has been considered (Zhong et al, 1993;Lafuente et al, 1993;Bell et al, 1993;Daly et al, 1993;Brockmoller et al, 1994;Lin et al, 1994). Some of these studies found a protective effect of GSTM1 in bladder cancer (Table I).…”

mentioning

confidence: 99%

Influence of smoking in the glutathione-S-transferase M1 deficiency - associated risk for squamous cell carcinoma of the bladder in schistosomiasis patients in Egypt

Lafuente

Zakahary²,

Elaziz³

et al. 1996

Br J Cancer

View full text Add to dashboard Cite

Summary In this study we show an effect of the glutathione-S-transferase MI (GSTM1) null phenotype on the risk for squamous cell carcinoma (SCC) of the bladder among male smokers in Egypt, with an adjusted odds ratio of 4.8 (95% confidence interval:1.06-21.77). However, no overall effect of the GSTM1 null phenotype on the risk for bladder SCC was observed.Keywords: glutathione-S-transferase; bladder cancer; schistosomiasis; free radical Carcinoma of the urinary bladder is the most common malignancy in many tropical and subtropical countries. There is a well-documented association with chronic urinary schistosomal infection, resulting in squamous cell carcinoma of the bladder (SCC), which is a major cause of morbidity and mortality in the endemic areas (IARC, 1994). Furthermore, foreign compounds from tobacco smoking may be involved in up to 50% of bladder cancers (transitional cell carcinoma, TCC) in western populations (Cole et al., 1971), through metabolic intermediates, most of them probably oxidised metabolites from N-nitroso-compounds, aromatic amines and polycyclic aromatic hydrocarbons (IARC, 1986;Wynder and Goldsmith, 1977).Glutathione-S-transferase Ml (GSTM 1) detoxifies various carcinogenic electrophiles including epoxides. A protective role against neoplasias associated with smoking has, therefore, been attributed to it. GSTM 1 has polymorphic expression and about half the population in various racial groups lack it (Hussey et al., 1986). Indeed, a greater susceptibility to lung (Seidegard et al., 1990) and larynx cancer (Lafuente et al., 1933) has been shown among smokers lacking GSTM1. Susceptibility to bladder cancer has also been studied, although only transitional cell carcinoma has been considered (Zhong et al., 1993;Lafuente et al., 1993;Bell et al., 1993;Daly et al., 1993;Brockmoller et al., 1994;Lin et al., 1994). Some of these studies found a protective effect of GSTM1 in bladder cancer (Table I).We, therefore, designed a study to determine whether GSTM1 deficiency may confer susceptibility to the squamous cell carcinoma of the bladder associated with schistosomiasis. Our hypothesis is based on the antioxidant properties of this isoenzyme, which is able to metabolise the hydroperoxides of DNA that may be produced in chronic inflammation (Ketterer and Meyer, 1989;Lafuente et al., 1995). Although SCC of the bladder is not known to be related to smoking, we have attempted to assess the influence of the smoking habit on this carcinogenic process, given the role of the GST system in the metabolism of the toxic products of tobacco. Materials and methodsEighty bladder SCC patients were recruited at the Urology Department of the University of Assiut, Egypt, between 1993 and 1994; 66 patients were men (mean age 45.2+6.5 years) and 14 were women (mean age 41.0+7 years). All had histologically proven SCC of the bladder and none had received prior chemotherapy or radiotherapy. All tumours were deeply invasive (pT3 and pT4).Seventy unrelated control individuals (C) without clinical or histological evide...

show abstract

Human glutathione S-transferase mu (GSTμ) deficiency as a marker for the susceptibility to bladder and larynx cancer among smokers and malignant melanoma

Cited by 14 publications

References 0 publications

Relationship of tobacco smoking with GSTM1 gene polymorphism in laringeal cancer

Relationship of tobacco smoking with GSTM1 gene polymorphism in laringeal cancer

Glutathione S-transferase genotypes in children who develop treatment-related acute myeloid malignancies

Influence of smoking in the glutathione-S-transferase M1 deficiency - associated risk for squamous cell carcinoma of the bladder in schistosomiasis patients in Egypt

Contact Info

Product

Resources

About