Hybrid expression cassettes consisting of a milk protein promoter and a cytomegalovirus enhancer significantly increase mammary‐specific expression of human lactoferrin in transgenic mice

Abstract

It is very important to develop an effective, specific, and robust expression cassette that ensures a high level of expression in the mammary glands. In this study, we designed and constructed a series of mammary gland-specific vectors containing a complex hybrid promoter/enhancer by utilizing promoter sequences from milk proteins (i.e., goat β-casein, bovine αs1-casein, or goat β-lactoglobulin) and cytomegalovirus enhancer sequences; vectors containing a single milk protein promoter served as controls. Chicken β-globin insulator sequences were also included in some of these vectors. The expression of constructs was analyzed through the generation of transgenic mice. Enzyme-linked immunosorbent assay (ELISA) analysis revealed that the hybrid promoter/enhancer could drive the expression of recombinant human lactoferrin (rhLF) cDNA at high levels (1.17-8.10 mg/ml) in the milk of transgenic mice, whereas control promoters achieved a very low rhLF expression (7-40 ng/ml). Moreover, the expression of rhLF was not detected in the serum or saliva of any transgenic animal. This result shows that all constructs, driven by the hybrid promoter/enhancer, had high mammary gland-specific expression pattern. Together, our results suggest that the use of a hybrid promoter/enhancer is a valuable alternative approach for increasing mammary-specific expression of recombinant hLF in a transgenic mouse model.

Expression of Recombinant Human Alpha-Lactalbumin in the Milk of Transgenic Goats Using a Hybrid Pomoter/Enhancer

“…In our previous study, the strategy of a BLG/CMV based vector efficiently drove the human lactoferrin cDNA gene to express in the milk of transgenic mice [7]. Because the first step for the production of transgenic goats was to determine whether the expression vector can drive hLA to express in the mammary gland, CMGECs were needed to study the protein expression [18, 24]; Western blot results demonstrated that the transgenic CMGECs (eight colonies) expressed recombinant hLA at 0.9–4  μ g/mL in the supernatants.…”

“…X05153.1), which contained exon 1-4, intron 1-3, and poly A sequence (2.36 kb), was prepared by polymerase chain reaction (PCR) using human blood DNA as the template with primer sets (sense: GCTCGAGATGAGGTT CTTTGTC CCTC; antisense: GCTCGAGTGACTTCAAAGTGGGACC). To facilitate the subcloning into pBCc [7], the Xho I (TAKARA) site was added to the 5′ and 3′-terminal end. The PCR reactions consisted of 94°C for 3 min in the first instance, 94°C for 40 sec, and 68°C for 4 min for 30 cycles, with a final extension of 72°C for 5 min.…”

“…Constructs with milk protein gene loci could be an ideal strategy for high level expression of foreign genes [2, 4, 5], but it is often difficult to manipulate the large size of the vector into donor cells for nuclear transfer [3, 6]. In our previous studies [7], a hybrid milk protein promoter (goat β -casein, bovine α s1-casein, and goat β -lactoglobulin (BLG)) with cytomegalovirus (CMV) enhancer was constructed and the expression level of recombinant human lactoferrin in the milk of transgenic mice was up to 8.2 mg/mL, which was more effective than using a single milk protein promoter (7–40 ng/mL). Therefore, construction of a hybrid milk protein promoter with enhancer is an attractive way to improve the expression level of recombinant proteins.…”

Human lactoferrin efficiently targeted into caprine beta-lactoglobulin locus with transcription activator-like effector nucleases

“…pBLC-TK construct was prepared by insertion of Xho I- Xho I fragment (4.37 kb) from plasmid Porf-hsv1tk (Invivogen, San Diego, CA, USA) into pBLC14 at the Sal I site [17], which was located downstream BLG 3′flanking sequence. The vector was constructed with a combination of standard enzyme restriction/ligation and In-Fusion cloning method and the target vector was linearized with Not I and Sal I before electroporation.…”

“…F1 fibroblasts were isolated from 43d fetus of one pregnancy and conducted secondary SCNT using F1 fibroblasts as donors according to the protocol descrived above [17]. Consisely, oocytes enucleation was performed under UV light, and a single fibroblast cell was injected into the perivitelline space of an enucleated oocyte in M 2 (Sigma, USA) medium supplemented with 10% FCS (HyClone, Beijing, China), 2 μg/mL Hoechst 33342 (Sigma, USA) and 7.5 μg/mL cytochalasin B (Sigma, USA).…”