Hydrogen Peroxide Mediates Vascular Cell Adhesion Molecule–1 Expression From Interleukin–18-Activated Hepatic Sinusoidal Endothelium: Implications for Circulating Cancer Cell Arrest in the Murine Liver

Abstract

The mechanism of intrasinusoidal arrest of circulating cancer cells, which is a critical step in liver metastasis, appears to be facilitated by tumor-derived proinflammatory factors that increase sinusoidal cell adhesion receptors for cancer cells. However, how this prometastatic microenvironment is up-regulated remains unknown. Using intrasplenically injected B16 melanoma (B16M) cells, we show that the expression of vascular cell adhesion molecule-1 (VCAM-1) significantly increased in hepatic sinusoidal endothelium (HSE) cells over physiologic baseline within the first 24 hours of metastatic cancer cell infiltration in the liver. This correlated with increased in vitro adhesion of B16M cells to HSE cells isolated from B16M cell-injected mice. In vivo VCAM-1 blockade with specific antibodies before B16M cell injection decreased sinusoidal retention of luciferase-transfected B16M cells by 85%, and metastasis development by 75%, indicating that VCAM-1 expression on tumor-activated HSE cells had a prometastatic contribution. Because VCAM-1 expression is oxidative stress-inducible, recombinant catalase was in vivo administered, resulting in a complete abrogation of both VCAM-1 expression and B16M cell adhesion increases in HSE cells isolated from B16M cell-injected mice. Catalase also abrogated the proadhesive response of HSE cells to B16M-conditioned medium (B16M-CM) in vitro, although this did not affect the concomitant release of major proinflammatory cytokines by HSE cells.

The Host Inflammatory Response Promotes Liver Metastasis by Increasing Tumor Cell Arrest and Extravasation

“…This suggests that VCAM-1 up-regulation can occur independently of increased TNF-␣ or IL-1 levels, possibly as a response to other liver or tumor-derived cytokines such as IL-18 40 or oxidative stress triggered by tumor cell entry into the blood vessels. 41 The finding that in the athymic mice MIP-101 induced a weaker VCAM-1 signal suggests that T cells may also be involved in this response, and this is in agreement with data based on in vitro studies that implicated resting and activated T cells in VCAM-1 induction on endothelial cells. 42 The increase in VCAM-1 expression did not, however, result in MIP-101 adhesion or transmigration, consistent with the reported failure of these cells to adhere to VCAM-1 on cultured endothelial cells.…”

Proangiogenic Role of Tumor–Activated Hepatic Stellate Cells in Experimental Melanoma Metastasis

“…Adult male Sprague-Dawley rats and C57BL/6J mice (IFFA Credo) were used. Sinusoidal cells were separated by enzymatic perfusion followed by metrizamide gradient, as previously described, 7 and cultured on 0.001% type I collagen-coated wells (0.5 ϫ 10 6 cells/ cm 2 ) in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal calf serum (FCS) (both from Sigma Chemicals, St Louis, MO). After 2 hours, cells were washed and HSE cell purity assessed by ovalbumin endocytosis (Ͼ95%).…”

“…First-strand complementary DNA (cDNA) was generated from 5 g of total RNA with the Moloney murine leukemia virus reverse transcriptase (Gibco BRL), as previously described. 7 Quantitative real-time polymerase chain reaction (PCR) was performed in triplicate in 25 L with the Sybr Green PCR Core Reagent kit and the Gene Amp 5700 sequence detection system (all from PE Applied Biosytems, Foster City, CA) as previously described 7 with the following primers for murine VEGF: 5ЈGAGACCCTGGTGGACATC3Ј and 5ЈTTTCTTT-GGTCTGCATTC3Ј (this set of primers amplified the conserved region of all VEGF splicing forms); for murine ␤-actin, 5ЈGCCTTCCTTCTTGGGTATGG3Ј and 5Ј-ACGCAGCTCAGTAACAGTCC3Ј. Each PCR run included 5 points of the standard curve (titrated dilutions of plasmid containing the specific fragment to evaluate), a no-template control, the calibrator cDNA, and cDNA obtained from HSC-T6 cells.…”

“…[1][2][3] These cells may result from a transdifferentiation process of quiescent hepatic stellate cells (HSCs) and other perivascular fibroblasts, induced by tumor cells [4][5][6] and tumor-activated sinusoidal cells. 7 Tumor-activated HSCs are responsible for the remodeling and deposition of tumor-associated extracellular matrix [8][9][10] and have been involved in the migration and growth of hepatoma and metastatic cells. [4][5][6]11,12 HSCs also synthesize vascular endothelial growth factor (VEGF) upon in vitro activation and in response to hypoxia, 13 suggesting their additional contribution to the angiogenic needs of developing hepatic tumors.…”

Vitamins C and E downregulate vascular VEGF and VEGFR-2 expression in apolipoprotein-E-deficient mice

“…PCR was performed as previously described (95 • C for 10 min and run for 40 cycles at 95 • C for 15 s and 60 • C for 1 min) with SYBR Green PCR Master Mix (Applied Biosystems) on the ABI PRISM 5700 Detection System (Applied Biosystems) [21]. Potential genomic DNA contamination was excluded by using intron-encompassing primers.…”