Hypofibrinogenemia in an individual with 2 coding (γ82 A→G and Bβ235 P→L) and 2 noncoding mutations

Abstract

We investigated the molecular basis of hypofibrinogenemia in a man with a normal thrombin clotting time. Protein analysis indicated equal plasma expression of 2 different Bβ alleles, and DNA sequencing confirmed heterozygosity for a new Bβ235 P→L mutation. Protein analysis also revealed a novel γD chain, present at a ratio of 1:2 relative to the γA chain. Mass spectrometry indicated a 14 d decrease in the γD-chain mass, and DNA sequencing showed this was caused by a novel γ82 A→G substitution. DNA sequencing established heterozygosity for 2 further mutations: T→C in intron 4 of the A gene and A→C in the 3′ noncoding region of the Bβ gene. Studies on the man's daughter, together with plasma expression levels, discounted both the A and Bβ mutations as the cause of the low fibrinogen, suggesting that the γ82 mutation caused the hypofibrinogenemia. This was supported by analysis of 31 normal controls in whom the Bβ mutations were found at polymorphic levels, with an allelic frequency of 5% for the Bβ235 mutation and 42% for the Bβ 3′ untranslated mutation. The γ82 mutation was, however, unique to the propositus. Residue γ82 is located in the triple helix that separates the E and D domains, and aberrant packing of the helices may explain the decreased fibrinogen concentration.

Molecular Mechanisms of Hypo‐ and Afibrinogenemia

“…In these cases fibrinogen chain composition can be examined directly by SDS PAGE, reverse phase HPLC, isoelectric focussing, or by electrospray or matrix assisted laser desorption mass spectrometry. 6,15,20,29 If these prove inconclusive, then various peptide mapping procedures can be employed. In these cases mass spectrometry offers a major advantage over traditional mapping methods because it is possible to predict the exact m/z location of both the variant and normal peptides, permitting a definitive conclusion concerning expression level.…”

“…In these cases mass spectrometry offers a major advantage over traditional mapping methods because it is possible to predict the exact m/z location of both the variant and normal peptides, permitting a definitive conclusion concerning expression level. 15,20 Caution is needed in assessing how a DNA mutation might induce hypofibrinogenemia. For example: (1) Point mutations in exons, as well as introns, might activate cryptic splice sites.…”

“…The Dunedin mutation (γ82 Ala→Gly) is actually expressed in the circulatory fibrinogen of heterozygotes, albeit at a reduced ratio (1: 2) to γ A chains. 20,21 The lesion occurs near the plasmin sensitive site in the coiled coil connecting the E and D domains. Glycine is grossly under-represented in the triple helix, accounting for only three of 337 residues and destabilized coil packing together with increased proteolytic sensitivity may account for the decreased fibrinogen levels.…”

Identification and Characterization of Five New Fibrinogen Gene Polymorphisms

“…Subsequent genotyping of 50 unrelated control subjects was performed by PCR and restriction enzyme digestion as described elsewhere. [6][7][8] The A α Dde I polymorphism was amplified with the primers 3137 α (acagcatatccagcttctgca) and 3283 α (gtagacactcagtgcataactat) and digested directly with Dde I. The γ intron 9 polymorphism was amplified with the primers 7819 γ (gatttgtagaaaaattactgtta) and 7952 γ (ccattgaaggctaaatgtcc) and digested directly with Hpa I.…”

Hypofibrinogenemia Associated with a Heterozygous C→T Nucleotide Substitution at Position −1138 BP of the 5′‐Flanking Region of the Fibrinogen Aα‐Chain Gene

“…In the last two years, 14 abnormalities of the fibrinogen A α -, B β -, and γ -chain gene have been reported in congenital afibrinogenemias or hypofibrinogenemias. [1][2][3][4][5] In this report, we demonstrated the hypofibrinogenemia associated with a novel genetic abnormality, heterozygous C → T nucleotide substitution at position − 1138 bp in the 5 ′ -flanking region of the fibrinogen A α gene that led to reduced transcriptional activity of luciferase.…”