Hypolipidemic effects of HVC1 in a high cholesterol diet-induced rat model of hyperlipidemia

Abstract

HVC1, a novel formation containing four herbs, was developed and its hypolipidemic effects in rats with high cholesterol diet (HCD)-induced hyperlipidemia were investigated. The rats were given a HCD for 8 weeks. The HVC1-treated groups were orally administered HVC1 at doses of 10, 50 or 250 mg/kg, respectively, and the simvastatin group was treated at a dose of 10 mg/kg. The normal diet and HCD control groups were administered with physiological saline. Oral administration of HVC1 (10, 50 or 250 mg/kg) significantly reduced the body weight of rats with hyperlipidemia and regulated the total cholesterol, low-density lipoprotein cholesterol and high-density lipoprotein cholesterol levels in the serum. In addition, tissue analysis revealed that lipid accumulation in the liver and aorta was reduced by HVC1 administration. Furthermore, HVC1 significantly reduced the mRNA expression of peroxisome proliferator-activated receptor-γ, 3-hydroxy-3-methylglutaryl-CoA reductase and low-density lipoprotein receptor, as well as the protein level of 5′ adenosine monophosphate-activated protein kinase in the liver. The results clearly demonstrate that HVC1 has a potent hypolipidemic effect, and suggest that HVC1 should be evaluated as a potential treatment for hyperlipidemia.

The anti-obesity effects of Tongbi-san in a high-fat diet-induced obese mouse model

“…The liver and epididymal WAT were homogenized, and the total RNA was isolated using the Easy-Blue® reagent according to the manufacturer’s instructions (Intron Biotechnology; Seongnam, Republic of Korea). The cDNA was synthesized according to a previously reported procedure [22]. The oligonucleotide primers for mouse PPARγ were ATCGAGTGCCGAGTCTGTGG (forward) and GCAAGGCACTTCTGAAACCG (reverse); for mouse C/EBPα were GGAACTTGAAGCACAATCGATC (forward) and TGGTTTAGCATAGACGTGCACA (reverse); for mouse SREBP1 were ATCGCAAACAAGCTGACCTG (forward) and AGATCCAGGTTTGAGGTGGG (reverse); for mouse AMPK were GGTGGATTCCCAAAAGTGCT (forward) and AAGCAGTGCTGGGTCACAAG (reverse); for mouse GAPDH were GACGGCCGCATCTTCTTGT (forward) and CACACCGACCTTCACCATTTT (reverse).…”

Effects of oral selenium and magnesium co-supplementation on lipid metabolism, antioxidative status, histopathological lesions, and related gene expression in rats fed a high-fat diet

“…Hyperlipidemia is a lipid metabolism disorder that causes abnormally elevated levels of cholesterol (TC), triglycerides (TG) and lipoproteins in the blood. Hyperlipidemia is widely accepted to be a key risk factor for atherosclerosis, coronary heart disease (CHD) and peripheral vascular disease [ 1 ]. Statins are widely used in clinical practice to reduce low-density lipoprotein cholesterol levels and decreasing cardiovascular events.…”

“…However, because of the high prices and intolerance, side effects or, simply, patient preference, it is more and more impending to explore more effective and safer alternative therapies to hyperlipidemia. Nutraceuticals and functional food ingredients that are beneficial to vascular health may represent useful compounds that are able to reduce the overall cardiovascular risk induced by dyslipidaemia by acting parallel to statins or as adjuvants in case of failure or in situations where statins cannot be used [ 1 , 2 ].…”

Quality of Dabai Pulp Oil Extracted by Supercritical Carbon Dioxide and Supplementation in Hypercholesterolemic Rat—A New Alternative Fat

“…Additionally, the elevated inflammatory markers and reduced anti-oxidant enzymes in hypercholesterolemic rats indicate that hypercholesterolemia was associated with oxidative stress and inflammation. The difference in lipid profile, inflammatory markers and anti-oxidant enzymes between normal rats and hypercholesterolemic rats fed with high cholesterol diet was demonstrated in previous studies [ 37 , 38 , 39 ].…”