Hypoxia-Induced Mesenchymal Stem Cells Exhibit Stronger Tenogenic Differentiation Capacities and Promote Patellar Tendon Repair in Rabbits

Abstract

Tendon injury is a common but tough medical problem. Unsatisfactory clinical results have been reported in tendon repair using mesenchymal stem cell (MSC) therapy, creating a need for a better strategy to induce MSCs to tenogenic differentiation. This study was designed to examine the effect of hypoxia on the tenogenic differentiation of different MSCs and their tenogenic differentiation capacities under hypoxia condition in vitro and to investigate the in vivo inductility of hypoxia in tenogenesis. Adipose tissue-derived MSCs (AMSCs) and bone marrow-derived MSCs (BMSCs) were isolated and characterized. The expression of hypoxia-induced factor-1 alpha (Hif-1α) was examined to confirm the establishment of hypoxia condition. qRT-PCR, western blot, and immunofluorescence staining were used to evaluate the expression of tendon-associated marker Col-1a1, Col-3a1, Dcn, and Tnmd in AMSCs and BMSCs under hypoxia condition, compared with Tgf-β1 induction. In vivo, a patellar tendon injury model was established. Normoxic and hypoxic BMSCs were cultured and implanted. Histological, biomechanical, and transmission electron microscopy analyses were performed to assess the improved healing effect of hypoxic BMSCs on tendon injury. Our in vitro results showed that hypoxia remarkably increased the expression of Hif-1α and that hypoxia not only promoted a significant increase in tenogenic markers in both AMSCs and BMSCs compared with the normoxia group but also showed higher inductility compared with Tgf-β1. In addition, hypoxic BMSCs exhibited higher potential of tenogenic differentiation than hypoxic AMSCs. Our in vivo results demonstrated that hypoxic BMSCs possessed better histological and biomechanical properties than normoxic BMSCs, as evidenced by histological scores, patellar tendon biomechanical parameters, and the range and average of collagen fibril diameters. These findings suggested that hypoxia may be a practical and reliable strategy to induce tenogenic differentiation of BMSCs for tendon repair and could enhance the effectiveness of MSCs therapy in treating tendon injury.

Mkx Mediates Tenogenic Differentiation But Incompletely Inhibits The Proliferation of Hypoxic MSCs

“…Similarly, the protein levels of the above tenogenic differentiation markers in the siRNA group were also signi cantly lower than those in the scramble group in both normoxia condition and hypoxia condition (Fig. 2i, Supplementary Figure 6- 15). As shown in Fig.…”

“…Although the improved effects of hypoxia on tenogenic differentiation of MSCs have been reported [8, 12,13,15], none of them conducted research about the underlying mechanism of tenogenesis in hypoxia condition. In the present study, we detected that the expression level of Mkx was signi cantly enhanced in hypoxic AMSCs and hypoxic BMSCs in comparison to that of normoxic MSCs, respectively, and that the hypoxia and shRNA group showed signi cantly lower expression of tendon-speci c markers in vitro and worse histological and biomechanical properties in vivo than those of the hypoxia and scramble group in BMSCs.…”

“…Tnmd was considered to be an important and speci c collagen matrix in tendon formation [8,15]. In our previous study, Tnmd was found to be the highest expression gene of MSCs in mRNA and protein level under hypoxia condition [15].…”

“…The primer sequences of Mkx synthesized by Sangon Biotech Co., Ltd. (Shanghai, China) were: forward: CCAGAGTGCGTGTGCTACAG; reverse: AAATGCTACCACAGGGCTGC. Other primer sequences of tendon-speci c genes were same to our previous report [15]. Speci city of primers was examined by the melting curve.…”

“…The protein expression of Mkx and other tendon-speci c genes were measured with Western blot using the same condition as described previously [15]. Proteins were extracted using RIPA Lysis Buffer (Shanghai Weiao Biotechnology Co., Ltd., China).…”