<i>CLLU1</i> expression levels predict time to initiation of therapy and overall survival in chronic lymphocytic leukemia

Buhl, Anne Mette; Jurlander, Jesper; Geisler, Christian H.; Pedersen, Lone Bredo; Andersen, Mette Klarskov; Josefsson, Pär; Petersen, Jørgen Holm; Leffers, Henrik

doi:10.1111/j.0902-4441.2005.t01-1-ejh2530.x

Cited by 35 publications

(37 citation statements)

References 49 publications

(64 reference statements)

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…[18][19][20] We were able to confirm these findings, particularly with regards to unmutated IGHV status, ZAP-70 and CD38 positivity, absence of 13q deletion and raised levels of b 2 -microglobulin.…”

Section: © F E R R a T A S T O R T I F O U N D A T I O Nsupporting

confidence: 60%

“…The prognostic value of CLLU1 mRNA expression has previously been investigated in four retrospective studies, 13,15,16,20 including between 59 and 252 patients each and at a median follow-up from diagnosis of between 43 and 102 months. The end-points in all four studies were time to first treatment and overall survival from diagnosis.…”

Section: Discussionmentioning

confidence: 99%

“…CLLU1 mRNA expression levels were assessed by quantitative reverse-transcription polymerase chain reaction (RT-PCR) using B2M as the endogenous control, as described previously. 20 In brief, CLLU1 and B2M were amplified in duplicate in a 7500 Fast Real-Time PCR stystem (LifeTechnologies) using 5 μL of cDNA in a total volume of 25 μL containing TaqMan Fast Universal PCR Master Mix (LifeTechnologies), and 200 μM of primers/probes. The ΔΔCt method was used, with RNA extracted from a normal B-cell pool as a calibrator, to calculate the relative expression of CLLU1.…”

Section: Patients and Samplesmentioning

confidence: 99%

“…18 In particular, high CLLU1 expression (CLLU1-H) is significantly more frequent in unmutated IGHV and CD38 + CLL. 19,20 CLLU1-H has been shown to be associated with shorter overall survival and shorter time to first treatment in patients with early stage CLL, 20 especially those younger than 70 years. 13 In addition, CLLU1 expression has been shown to be a specific and stable marker in CLL cells, 21 making it a promising marker not only for prognosis but also for minimal residual disease analysis.…”

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

CLLU1 expression has prognostic value in chronic lymphocytic leukemia after first-line therapy in younger patients and in those with mutated IGHV genes

et al. 2012

View full text Add to dashboard Cite

Articles Chronic Lymphocytic Leukemia 274haematologica | 2013; 98(2) IntroductionChronic lymphocytic leukemia (CLL) is a heterogeneous disease with a highly variable outcome depending on clinical and biological characteristics. Clinical staging is a relatively simple method of assessing the outcome of CLL patients based on clinical parameters.1,2 In the last two decades, multiple biological markers have been shown to have prognostic relevance in CLL, most notably chromosomal aberrations, IGHV mutations and expression of surface markers such as ZAP-70 and CD38. [3][4][5][6][7][8] Gene expression analyses have also revealed the heterogeneity of CLL, with distinct gene expression signatures being associated with particular genetic subgroups of CLL. [9][10][11] In particular, the expression of genes such as CLLU1, ADAM29 and LPL have recently been associated with different outcomes in CLL. [12][13][14][15][16][17] CLLU1 located at chromosome 12q22, encodes a novel transcript, which has been identified as a marker specific to CLL. 18 In particular, high CLLU1 expression (CLLU1-H) is significantly more frequent in unmutated IGHV and CD38 + CLL. 19,20 CLLU1-H has been shown to be associated with shorter overall survival and shorter time to first treatment in patients with early stage CLL, 20 especially those younger than 70 years. 13 In addition, CLLU1 expression has been shown to be a specific and stable marker in CLL cells, 21 making it a promising marker not only for prognosis but also for minimal residual disease analysis. 22 However, the effect of CLLU1 expression on response to therapy is currently unknown and, to date, there are no data on the significance of CLLU1 expression with regards to progression-free survival and overall survival in patients receiving first-line therapy. We assessed the value of CLLU1 expression as a prognostic marker in the LRF CLL4 randomized controlled trial. Design and Methods Patients and samplesPre-treatment blood samples were collected at the time of entry into the trial and were available for CLLU1 expression analysis from 515 of the 777 patients. The patients were previously untreated, 25% having Binet stage A-progressive disease, 45% stage B and 30% stage C. The male:female ratio was 3:1 and the median age was 65 years (range, 35-86 years). Patients were randomized to receive chlorambucil, fludarabine, or fludarabine with cyclophosphamide. The trial was approved by a multicenter research ethics committee and all patients gave informed consent. RNA extraction and CLLU1 expression analysisRNA was extracted using the RNeasy Mini Kit (Qiagen) after which ©2013 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2012.070201 DG and ME contributed CLLU1, located at chromosome 12q22, encodes a transcript specific to chronic lymphocytic leukemia and has potential prognostic value. We assessed the value of CLLU1 expression in the LRF CLL4 randomized trial. Samples from 515 patients with chronic lymphocytic leukemia were collected immediately before the start ...

show abstract

Section: © F E R R a T A S T O R T I F O U N D A T I O Nsupporting

confidence: 60%

Section: Discussionmentioning

confidence: 99%

Section: Patients and Samplesmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

CLLU1 expression has prognostic value in chronic lymphocytic leukemia after first-line therapy in younger patients and in those with mutated IGHV genes

et al. 2012

View full text Add to dashboard Cite

show abstract

“…RQ-PCR for FMOD and CLLU1 was performed according to previously published procedures [26,27]. For TCL1 we used RT-PCR (forward primer: GGAGAAGTTCGTGTATTTGG, reverse: CGCCGTCAATCTTGATG).…”

Section: Real-time Quantitative Pcr (Rq-pcr)mentioning

confidence: 99%

Molecular characterization of neoplastic and normal “sister” lymphoblastoid B-cell lines from chronic lymphocytic leukemia

Myhrinder

Hellqvist

Bergh

et al. 2013

Leukemia & Lymphoma

Self Cite

View full text Add to dashboard Cite

Current Awareness in Hematological Oncology

2006

Hematological Oncology

View full text Add to dashboard Cite

In order to keep subscribers up‐to‐date with the latest developments in their field, John Wiley & Sons are providing a current awareness service in each issue of the journal. The bibliography contains newly published material in the field of hematological oncology. Each bibliography is divided into 14 sections: 1 Books, Reviews & Symposia; 2 General; Leukemias: 3 Lymphoblastic; 4 Myeloid & Myelodysplastic Syndromes; 5 Chronic; 6 Others; Lymphomas: 7 Hodgkin's; 8 Non‐Hodgkin's; 9 Plasmacytomas/Multiple Myelomas; 10 Others; 11 Bone Marrow Transplantation; 12 Cytokines; 13 Diagnosis; 14 Cytogenetics. Within each section, articles are listed in alphabetical order with respect to author. If, in the preceding period, no publications are located relevant to any one of these headings, that section will be omitted.

show abstract

CLLU1 expression levels predict time to initiation of therapy and overall survival in chronic lymphocytic leukemia

Abstract: CLLU1 is the first identified CLL specific gene. The CLLU1 mRNA expression level can predict time to initiation of treatment and survival in CLL patients.

Cited by 35 publications

References 49 publications

CLLU1 expression has prognostic value in chronic lymphocytic leukemia after first-line therapy in younger patients and in those with mutated IGHV genes

CLLU1 expression has prognostic value in chronic lymphocytic leukemia after first-line therapy in younger patients and in those with mutated IGHV genes

Molecular characterization of neoplastic and normal “sister” lymphoblastoid B-cell lines from chronic lymphocytic leukemia

Current Awareness in Hematological Oncology

Contact Info

Product

Resources

About