Descurainia sophia Ameliorates Eosinophil Infiltration and Airway Hyperresponsiveness by Reducing Th2 Cytokine Production in Asthmatic Mice

Abstract

In Chinese medicine, Descurainia sophia is used to treat cough by removing the phlegm in asthma and inflammatory airway disease, but the mechanism is not clear. In this study, we evaluated whether D. sophia water extract (DSWE) can alleviate airway inflammation and airway hyperresponsiveness (AHR) in the lungs of a murine asthma model. Female BALB/c mice were divided into five groups: normal controls, ovalbumin (OVA)-sensitized asthmatic mice, and OVA-sensitized mice treated with DSWE (2, 4, 8 g/day) by intraperitoneal injection. After sacrificing the mice, serum was collected to detect OVA-specific antibodies by ELISA, as well as bronchoalveolar lavage fluid (BALF) to detect cytokine levels. We also detected gene expression and histopathologically evaluated the lungs of asthmatic mice. DSWE reduced AHR, goblet cell hyperplasia, eosinophil infiltration, and collagen aggregation in the lungs of asthmatic mice. DSWE also suppressed the gene expression of Th2-associated cytokines and chemokines in lung tissue and inhibited serum OVA-IgE and Th2-associated cytokine levels in the BALF of OVA-sensitized mice. Our findings suggest that DSWE is a powerful immunomodulator for ameliorated allergic reactions by suppressing Th2 cytokine expression in asthmatic mice.

Network Pharmacology‐Based Study on the Mechanism of Pinellia ternata in Asthma Treatment

“…On day 21, the mice were intranasally (i.n.) administrated with 100 μ g OVA in 50 μ L [ 8 , 9 ]. The herb group was administrated with PT (1.95 g/kg/d) (provided by Affiliated Hospital of Shandong University of Traditional Chinese Medicine, China) water decoction for 21 days, whereas the control mice were given the identical volume of phosphate-buffered saline (PBS).…”

“…The concentrations of RNA were determined before reverse transcription. Total RNA (200 ng) was further reserve-transcribed to cDNA, and detail operation steps were done as previously described [ 9 ]. The primers used in the present study were as follows: for Mmp2 , sense CAAGTTCCCCGGCGATGTC and antisense TTCTGGTCAAGGTCACCTGTC; for il-4 , sense GGTCTCAACCCCCAGCTAGT and antisense GCCGATGATCTCTCTCAAGTGAT.…”

Biodiversity of wild spice plants of the Central Kazakhstan region and their medicinal potential

“…In Chinese medicine, it is used to treat cough by removing the phlegm in asthma and inflammatory airway diseases. The results show that D. sophia is a potent immunomodulator for attenuating allergic responses by suppressing Th2 cytokine expression in asthmatic mice (Ting et al 2019). Aqueous extract of D. sophia has an effect on the prevention and treatment of kidney stones (Saremi et al 2018), and its decoction has significant diuretic activity (Zeng et al 2018).…”

Protective effects of Descurainia sophia seeds extract and its fractions on pulmonary edema by untargeted urine and serum metabolomics strategy

“…Descurainia sophia (L.) Webb.ex Prantl, also known as “flixweed”, is a member of the Brassicaceae family ( Zhou et al, 2017 ). The dry ripe seed of D. sophia (DS; known as “Ting Li Zi” in Chinese) is a common herbal medicine used in northeast Asia ( Kim, S. B. et al, 2019 ) to cure pulmonary disorders caused by phlegm-fluid retention (e.g., asthma, cough, edema) ( Baek et al, 2018 ; Luo et al, 2018 ; Ting et al, 2019 ). However, studies on its therapeutic effect on pulmonary diseases are scarce.…”