<i>In vitro</i>
            and
            <i>in vivo</i>
            characterization of novel mRNA motifs that bind special elongation factor SelB

Klug, Stefanie J.; Hüttenhofer, Alexander; Kromayer, M.; Famulok, Michael

doi:10.1073/pnas.94.13.6676

Cited by 73 publications

(46 citation statements)

References 30 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…UGA-directed selenocysteine incorporation requires that this structure be located 11 nucleotides (nt) from the UGA codon (bold) (18). The U residue at position 17 is bulged (12,18). The pairing of boxes C 20 and G 27 is questionable (18) and is therefore designated by a dot instead of by a dash.…”

Section: Resultsmentioning

confidence: 99%

See 1 more Smart Citation

The Bulged Nucleotide in the Escherichia coli Minimal Selenocysteine Insertion Sequence Participates in Interaction with SelB: a Genetic Approach

Li¹,

Reches²,

Engelberg‐Kulka³

2000

J Bacteriol

View full text Add to dashboard Cite

The UGA codon, which usually acts as a stop codon, can also direct the incorporation into a protein of the amino acid selenocysteine. This UGA decoding process requires a cis-acting mRNA element called the selenocysteine insertion sequence (SECIS), which can form a stem-loop structure. In Escherichia coli, selenocysteine incorporation requires only the 17-nucleotide-long upper stem-loop structure of the fdhF SECIS. This structure carries a bulged nucleotide U at position 17. Here we asked whether the single bulged nucleotide located in the upper stem-loop structure of the E. coli fdhF SECIS is involved in the in vivo interaction with SelB. We used a genetic approach, generating and characterizing selB mutations that suppress mutations of the bulged nucleotide in the SECIS. All the selB suppressor mutations isolated were clustered in a region corresponding to 28 amino acids in the SelB C-terminal subdomain 4b. These selB suppressor mutations were also found to suppress mutations in either the loop or the upper stem of the E. coli SECIS. Thus, the E. coli SECIS upper stem-loop structure can be considered a "single suppressible unit," suggesting that there is some flexibility to the nature of the interaction between this element and SelB.The UGA codon, which usually acts as a stop codon, can also direct incorporation of the amino acid selenocysteine (for reviews, see references 4, 5, 7, and 25). This UGA decoding process requires a cis-acting mRNA element called the selenocysteine insertion sequence (SECIS), which can form a stemloop structure (4, 9, 15; for reviews, see references 2 and 20).In Escherichia coli, a number of genes have been identified in which the UGA directs the incorporation of selenocysteine. These include genes fdhF (27) and fdnG (3), encoding the selenocysteine-containing enzymes formate dehydrogenase H and N, respectively. Immediately downstream from the selenocysteine-specifying UGA in the mRNA of each of these polypeptides is found a SECIS that has been described as consisting of at least 40 nucleotides capable of forming a stem-loop RNA structure (2, 9). In later work, it was suggested that an extended fdhF SECIS was required, consisting of an additional helix of 7 bp in which the U and G residues of the UGA codon are included and the A residue is bulged out (10). After carrying out an extensive mutational analysis of the fdhF SECIS DNA, we found that for in vivo UGA-directed selenocysteine incorporation, there is no requirement for the whole stem-loop RNA structure of the E. coli fdhF SECIS (including the extended form) (18), as thought previously. Instead, the 17-bp upper stem-loop structure is sufficient to permit selenocysteine incorporation on the condition that it is located 11 nucleotides downstream from the UGA codon (Fig. 1). This mini upper stem-loop structure contains a bulged nucleotide, a U residue, located 17 nucleotides downstream from the UGA (Fig. 1). Selenocysteine incorporation into an fdhF-lacZЈ fusion polypeptide depends on both (i) the specificity of nucleotide 17 as a...

show abstract

Section: Resultsmentioning

confidence: 99%

“…Previously, we showed that this minihelix is the same 17-bp upper stem-loop structure that we showed is the minimal requirement for in vivo selenocysteine incorporation into a polypeptide (18). This minimal SECIS has a bulged nucleotide that has been shown to be crucial for selenocysteine incorporation (12,18).…”

Section: Discussionmentioning

confidence: 99%

The Bulged Nucleotide in the Escherichia coli Minimal Selenocysteine Insertion Sequence Participates in Interaction with SelB: a Genetic Approach

Li¹,

Reches²,

Engelberg‐Kulka³

2000

J Bacteriol

View full text Add to dashboard Cite

show abstract

“…Unbound RNAs were removed with selection buffer, and bound RNAs were eluted with denaturing buffer (30 mM Tris, pH 6.8͞20% glycerol͞2% SDS͞1 M DTT). Eluted RNA was amplified as described (24).…”

Section: Methodsmentioning

confidence: 99%

Controlling small guanine–nucleotide-exchange factor function through cytoplasmic RNA intramers

Mayer

Blind

Nagel

et al. 2001

Proc. Natl. Acad. Sci. U.S.A.

Self Cite

View full text Add to dashboard Cite

ADP-ribosylation factor (ARF) GTPases and their regulatory proteins have been implicated in the control of diverse biological functions. Two main classes of positive regulatory elements for ARF have been discovered so far: the large Sec7͞Gea and the small cytohesin͞ARNO families, respectively. These proteins harbor guanine-nucleotide-exchange factor (GEF) activity exerted by the common Sec7 domain. The availability of a specific inhibitor, the fungal metabolite brefeldin A, has enabled documentation of the involvement of the large GEFs in vesicle transport. However, because of the lack of such tools, the biological roles of the small GEFs have remained controversial. Here, we have selected a series of RNA aptamers that specifically recognize the Sec7 domain of cytohesin 1. Some aptamers inhibit guanine-nucleotide exchange on ARF1, thereby preventing ARF activation in vitro. Among them, aptamer M69 exhibited unexpected specificity for the small GEFs, because it does not interact with or inhibit the GEF activity of the related Gea2-Sec7 domain, a member of the class of large GEFs. The inhibitory effect demonstrated in vitro clearly is observed as well in vivo, based on the finding that M69 produces similar results as a dominantnegative, GEF-deficient mutant of cytohesin 1: when expressed in the cytoplasm of T-cells, M69 reduces stimulated adhesion to intercellular adhesion molecule-1 and results in a dramatic reorganization of F-actin distribution. These highly specific cellular effects suggest that the ARF-GEF activity of cytohesin 1 plays an important role in cytoskeletal remodeling events of lymphoid cells.

show abstract

“…An RNA library with a complexity of 5 ϫ 10 14 different molecules was synthesised by in vitro T7-transcription from the PCRamplified synthetic DNA pool MF76.1: 5Ј-TCTAATACGAC-TCACTATAGGGCGCTAAGTCCTCGCTCA-N40-ACGC-GCGACTCGGATCCT-3Ј; primer MF39.1: 5Ј-TCTAATA CGACTCACTATAGGGCGCTAA GTCCTCGCTCA-3Ј (italic, T7-promotor; bold, BamHI restriction site); primer Mic20.1: 5Ј-GTAGGATCCGAGTCGCGCGT-3Ј (bold, BamHI restriction site) as described (21). CNBr-activated Sepharose was derivatized with synthetic peptides (CD18cyt, MF2G) or blocked with Tris⅐HCl (pH 8.0) alone according to the manufacturer's protocol.…”

Section: Methodsmentioning

confidence: 99%

Cytoplasmic RNA modulators of an inside-out signal-transduction cascade

Blind

Kolanus

Famulok

1999

Proc. Natl. Acad. Sci. U.S.A.

Self Cite

View full text Add to dashboard Cite

A vaccinia virus-based RNA expression system enabled high-level cytoplasmic expression of RNA aptamers directed against the intracellular domain of the ␤2 integrin LFA-1, a transmembrane protein that mediates cell adhesion to intercellular adhesion molecule-1 (ICAM-1). In two different cell types, cytoplasmic expression of integrinbinding aptamers reduced inducible cell adhesion to ICAM-1. The aptamers specifically target, and thereby define, a functional cytoplasmic subdomain important for the regulation of cell adhesion in leukocytes. Our approach of aptamercontrolled blocking of signaling pathways in vivo could potentially be applied wherever targeted modulation of a signaltransduction cascade is desired.To understand or control the functions of individual intracellular protein subdomains in vivo, general strategies to create and employ specific modulators of macromolecular interactions are needed. Therefore, a major biological and medical challenge is to identify such selective tools (1-5). Here we describe an approach based on cytoplasmic domain recognition of the ␤2 integrin LFA-1 by synthetic ligand-binding RNA aptamers (6-11) isolated from a combinatorial RNA library, their high-level expression in the cytoplasm of leukocytes, and investigations into their biological effects in vivo.Integrins are versatile heterodimeric transmembrane proteins that mediate adhesive interactions with extracellular matrix and cell-specific counterreceptors and are implicated in diverse biological processes, including apoptosis, cell-cycle regulation, cell migration, blood clotting, memory, and leukocyte function (12). The cytoplasmic domains of integrins play important roles in regulating cell adhesion (13,14), probably by linking signaling events inside the cell to the extracellular domains, but the precise mechanisms are unclear. The ␤2 integrin LFA-1 (␣L␤2, CD11a͞CD18) mediates adhesion of leukocytes in immune and inflammatory responses by binding to cellular ligands (15), the intercellular adhesion molecules ICAM-1, -2, or -3. A large body of data implicates the cytoplasmic domain of the ␤2 chain in the regulation of LFA-1-mediated adhesiveness, presumably through its interactions with intracellular proteins and͞or the membraneproximal cytoskeleton (16), and some candidate cytoplasmic ligands have recently been identified (17)(18)(19)(20). Further insights into these mechanisms may be gained by specifically inhibiting the LFA-1-mediated inside-out signal transduction in vivo. Our objectives were the selection of aptamers that bind to the cytoplasmic domain of CD18, the development and application of a system allowing high-level expression of aptamers within the cytoplasm of leukocytes, and investigation into their biological effects in the context of the living cell.

show abstract

In vitro and in vivo characterization of novel mRNA motifs that bind special elongation factor SelB

Cited by 73 publications

References 30 publications

The Bulged Nucleotide in the Escherichia coli Minimal Selenocysteine Insertion Sequence Participates in Interaction with SelB: a Genetic Approach

The Bulged Nucleotide in the Escherichia coli Minimal Selenocysteine Insertion Sequence Participates in Interaction with SelB: a Genetic Approach

Controlling small guanine–nucleotide-exchange factor function through cytoplasmic RNA intramers

Cytoplasmic RNA modulators of an inside-out signal-transduction cascade

Contact Info

Product

Resources

About