<i>In vitro</i> effects of phlorotannins from <i>Ascophyllum nodosum</i> (brown seaweed) on rumen bacterial populations and fermentation

Wang, Yuxi; Alexander, Trevor W.; McAllister, Tim A.

doi:10.1002/jsfa.3717

Cited by 72 publications

(58 citation statements)

References 66 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Primers and annealing temperatures were as described previously for F. succinogenes, P. bryantii, R. flavefaciens, S. ruminantium (Tajima et al, 2001) and R. albus (Wang et al, 1997). Detailed information on PCR cycling conditions, plasmid standards and reference bacterial strains are as described by Wang et al (2009). Universal 16S primer sequences: 16S-F: CTCCTACGGGAGGCAGCAGT and 16S-R: TTACCGCGGCTGCTGGCAC were used to detect total bacteria using amplification conditions: one cycle at 95°C for 3 min, 30 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s. A total of 25 μL of PCR mixture containing 150 nM of each 16S primer was used.…”

Section: Methodsmentioning

confidence: 99%

Synergism of Cattle and Bison Inoculum on Ruminal Fermentation and Select Bacterial Communities in an Artificial Rumen (Rusitec) Fed a Barley Straw Based Diet

et al. 2016

View full text Add to dashboard Cite

This study evaluated the effect of increasing the proportion of bison relative to cattle inoculum on fermentation and microbial populations within an artificial rumen (Rusitec). The experiment was a completely randomized design with a factorial treatment structure (proportion cattle:bison inoculum; 0:100, 33:67, 67:33, and 100:0) replicated in two Rusitec apparatuses (n = 8 fermenters). The experiment was 15 d with 8 d of adaptation and 7 d of sampling. Fermenters were fed a diet of 70:30 barley straw:concentrate (DM basis). True digestibility of DM was determined after 48 h of incubation from d 13 to 15, and daily ammonia (NH3) and volatile fatty acid (VFA) production were measured on d 9–12. Protozoa counts were determined at d 9, 11, 13, and 15 and particle-associated bacteria (PAB) from d 13 to 15. Select bacterial populations in the PAB were measured using RT-qPCR. Fermenter was considered the experimental unit and day of sampling as a repeated measure. Increasing the proportion of bison inoculum resulted in a quadratic effect (P < 0.05) on straw, concentrate and total true DM disappearance and on straw and total neutral detergent fiber (aNDF) disappearance, with greater disappearances observed with mixed inoculum. There were no effect of source or proportion of inoculum on ADF disappearance (P > 0.05). Increasing bison inoculum linearly increased (P < 0.05) concentrate aNDF disappearance, total and concentrate N disappearance as well as total daily VFA and acetate production. A positive quadratic response (P < 0.05) was observed for daily NH3-N, propionate, butyrate, valerate, isovalerate and isobutyrate production, as well as the acetate:propionate ratio. Increasing the proportion of bison inoculum linearly increased (P < 0.05) total protozoa numbers. No effects were observed on pH, total gas and methane production, microbial N synthesis, or copies of 16S rRNA associated with total bacteria, Selenomonas ruminantium or Prevotella bryantii. Increasing bison inoculum had a quadratic effect (P < 0.05) on Fibrobacter succinogenes, and tended to linearly (P < 0.10) increase Ruminococcus flavefaciens and decrease (P < 0.05) Ruminococcus albus copy numbers. In conclusion, bison inoculum increased the degradation of feed protein and fiber. A mixture of cattle and bison rumen inoculum acted synergistically, increasing the DM and aNDF disappearance of barley straw.

show abstract

Section: Methodsmentioning

confidence: 99%

Synergism of Cattle and Bison Inoculum on Ruminal Fermentation and Select Bacterial Communities in an Artificial Rumen (Rusitec) Fed a Barley Straw Based Diet

et al. 2016

View full text Add to dashboard Cite

show abstract

“…Primers and annealing temperatures have been described previously for F. succinogenes, P. bryantii, R. amylophilus, R. flavefaciens, S. ruminantium and S. bovis , R. albus , total bacterial and methanogen 16S rRNA For PCR, 25 ng of extracted DNA template was added. Detailed information on PCR cycling conditions, plasmid standards and reference bacterial strains has been provided previously . Copies of species‐specific, total bacterial and methanogen 16S rRNA were used to estimate the abundance of microbial populations.…”

Section: Methodsmentioning

confidence: 99%

Effects of hop varieties on ruminal fermentation and bacterial community in an artificial rumen (rusitec)

Narvaez

Wang

et al. 2012

J Sci Food Agric

Self Cite

View full text Add to dashboard Cite

BACKGROUND: There is a growing interest in the use of hops (Humulus lupulus) as an alternative to antibiotics to manipulate ruminal fermentation. However, the effects of different hop varieties on ruminal fermentation and bacterial populations have not been studied. Here the effects of three hop varieties, Cascade (CAS), Millennium (MIL) and Teamaker (TM), at a level of 800 µg mL−1 inoculum on ruminal fermentation and microbial populations in an artificial rumen system (rusitec) fed a barley silage‐based total mixed ration were investigated. Bacterial populations were assessed using real‐time polymerase chain reaction and expressed as a percentage of total bacterial 16S rRNA gene copies. RESULTS: All hops reduced (P < 0.001) total gas, methane and the acetate:propionate ratio. Liquid‐associated Fibrobacter succinogenes, Ruminococcus albus and Streptococcus bovis were reduced (P < 0.05) by MIL and TM. Feed particle‐associated S. bovis was reduced (P < 0.01) by MIL and TM, but TM and CAS increased (P < 0.01) Ruminobacter amylophilus and Prevotella bryantii respectively. Methanogens were decreased (P < 0.05) by MIL in both liquid and solid fractions and by CAS in the solid fraction. The total amount of α‐ and β‐acids in hops affected the ruminal fermentation. CONCLUSION: Hop‐induced changes in fermentation and microbial populations may improve energy efficiency use in the rumen. Further research is needed to determine the effects of hops on in vivo ruminal fermentation, microbial populations and animal performance. Copyright © 2012 Society of Chemical Industry

show abstract

“…Moreover, they observed that the effect of CT depends on, among others, the molecular weight and chemical structure of tannins. Similarly, addition of phlorotannins to rumen bacterial cultures inhibited growth of Fibrobacter succinogenes, but stimulated growth of Streptococcus bovis and Prevotella bryantii (Wang et al, 2009). The lack of effect of tannins in these studies may be due to inhibitory effects on some bacterial species and stimulatory effects on others.…”

Section: Controlmentioning

confidence: 96%

Effects of Two Sources of Tannins (QuercusL. andVaccinium Vitis IdaeaL.) on Rumen Microbial Fermentation: anin VitroStudy

Cieślak

Zmora

Pers‐Kamczyc

et al. 2014

Italian Journal of Animal Science

View full text Add to dashboard Cite

The aim of the experiment was to determine the effect of different sources of tannins on the in vitro rumen fermentation with focus on methane production. In the experiment, a rumen simulation system (RUSITEC) equipped with 4 fermenters (1 L) was used in three replicated runs (6 d of adaptation and 4 d of sampling) to study the effects of Quercus cortex extract (QC), Vaccinium vitis idaea (VVI) dried leaf extract and a mixture of VVI/QC on rumen microbial fermentation. Fermenters were fed 10.9 g/d of dry matter (DM) of a 600:400 forage:concentrate diet. Treatments were control, QC (2.725 mL), VVI leaves 0.080 g) and mixture of QC/VVI (1.362 mL+0.040 g) and were randomly assigned to fermenters within periods. The equivalent of 2.5 g of tannins/kg dietary DM from three sources of tannins was evaluated. All tannin sources decreased CH4 and ammonia concentrations, as well as protozoa and methanogen counts (P<0.001). Vaccinium vitis idaea and QC/VVI tended (P=0.005) to reduce the acetate to propionate ratio. There were no changes in nutrient digestion. Results suggest that these sources of tannins, especially VVI have the potential to reduce rumen CH4 production and ammonia concentration without negative effects on in vitro DM digestibility, total volatile fatty acids and pH.

show abstract

In vitro effects of phlorotannins from Ascophyllum nodosum (brown seaweed) on rumen bacterial populations and fermentation

Cited by 72 publications

References 66 publications

Synergism of Cattle and Bison Inoculum on Ruminal Fermentation and Select Bacterial Communities in an Artificial Rumen (Rusitec) Fed a Barley Straw Based Diet

Synergism of Cattle and Bison Inoculum on Ruminal Fermentation and Select Bacterial Communities in an Artificial Rumen (Rusitec) Fed a Barley Straw Based Diet

Effects of hop varieties on ruminal fermentation and bacterial community in an artificial rumen (rusitec)

Effects of Two Sources of Tannins (QuercusL. andVaccinium Vitis IdaeaL.) on Rumen Microbial Fermentation: anin VitroStudy

Contact Info

Product

Resources

About