In VivoImpact of Met221 Substitution in GOB Metallo-β-Lactamase

Abstract

Metallo-␤-lactamases (M␤Ls) represent one of the main mechanisms of bacterial resistance against ␤-lactam antibiotics. The elucidation of their mechanism has been limited mostly by the structural diversity among their active sites. All M␤Ls structurally characterized so far present a Cys or a Ser residue at position 221, which is critical for catalysis. GOB lactamases stand as an exception within this picture, possessing a Met residue in this location. We studied different mutants in this position, and we show that Met221 is essential for protein stability, most likely due to its involvement in a hydrophobic core. In contrast to other known M␤Ls, residue 221 is not involved in metal binding or in catalysis in GOB enzymes, further highlighting the structural diversity of M␤Ls. We also demonstrate the usefulness of protein periplasmic profiles to assess the contribution of protein stability to antibiotic resistance. The expression of ␤-lactam-degrading enzymes (␤-lactamases) is the most prevalent mechanism of antibiotic resistance in bacteria (13, 31). Metallo-␤-lactamases (M␤Ls) employ Zn(II) as a catalytic cofactor to cleave the ␤-lactam ring, thus inactivating these antibiotics (2, 6-8, 13-15, 18, 31, 35). These enzymes are particularly worrisome in the clinical setting, in that they can hydrolyze a broad spectrum of ␤-lactam substrates (including the latest-generation carbapenems, such as meropenem and imipenem) and are resistant to most clinically employed inhibitors (2, 6-8, 15, 35). These facts, together with the worldwide dissemination of M␤L-encoding genes (21), raise a concerning clinical problem. In addition, the design of an efficient pan-M␤L inhibitor has been limited by the diversity of their active-site structures, catalytic profiles, and metal ion requirements for activity among different members of this family of enzymes (3,4,8,12,16,17).M␤Ls have been classified into subclasses B1, B2, and B3 based on their primary structures (14). Molecular structures solved by X-ray crystallography of M␤Ls from the three subclasses have revealed a common ␣␤/␤␣ sandwich fold (3,4,10,12,16,17,33). However, many differences exist regarding zinc coordination environments and metal site occupancies (Fig. 1). M␤Ls bind up to two metal ions in their active sites. In the broad-spectrum B1 and B3 enzymes, Zn1 is tetrahedrally coordinated to three histidine ligands (His116, His118, and His196) and a water/OH Ϫ molecule (3H site) (3,12,17,33). On the other hand, the coordination polyhedron of Zn2 in B1 enzymes is provided by Asp120, Cys221, His263, and one or two water molecules (DCH site) (4, 12). Notably, this site conforms the active species in mono-Zn(II) B2 enzymes (which hydrolyze only carbapenems) (16). Instead, two mutations (Cys221Ser and Arg121His) affect the Zn2 coordination geometry in B3 M␤Ls, where the metal ion is bound to Asp120, His121, His263 (DHH site), and one or two water molecules, while Ser221 is no longer a metal ligand (10,17,33). A remarkable exception is the B3 M␤L GOB from Elizabethkingia menin...

Crystal Structure of the Metallo-β-Lactamase GOB in the Periplasmic Dizinc Form Reveals an Unusual Metal Site

“…In addition, previous analyses of mutant GOB-18 Asp120Ser and metal-substituted GOB-18 derivatives showed that the Zn2 site is essential for catalysis and for the stabilization of an anionic intermediate in the hydrolysis of nitrocefin (29,57). On the other hand, even though replacement of Gln116 by an isosteric His residue was somewhat detrimental for the resistance profile conferred by GOB-18 (29,31), it had little effect on metal content or on the in vitro activity of dinuclear GOB-1 (30) and remetallated mono-Zn(II) GOB-18 (29). Indeed, mutations Gln116Asn and Gln116Ala, which are predicted to impact the structure of the Zn2 site through perturbations on the second coordination sphere (Fig.…”

“…GOB-18 was produced in the periplasmic space of E. coli C41(DE3) cells harboring the plasmid pKP-GOB-18 (29,31,32). This vector allows the production of recombinant GOB-18 as a C-terminal fusion to the leader peptide pelB (29,31).…”

“…Overexpression of GOB-18 in the cytoplasm results in an inactive Fe(III)-bound form, from which a mononuclear fully active Zn(II) variant can be prepared by metal chelation and remetallation in vitro (29). Instead, GOB exclusively binds Zn(II) when it is secreted into the bacterial periplasm (29,31).…”

“…GOB-type enzymes include 18 allelic variants, all of them expressed by E. meningoseptica, a pathogen responsible for neonatal meningitis and opportunistic infections in immunocompromised patients (26)(27)(28). So far, two GOB variants have been characterized biochemically, GOB-1 and GOB-18 (29)(30)(31)(32), which differ by three residues located far from the active site (29). Expression of GOB-1 in the periplasm of Escherichia coli led to a di-Zn(II) enzyme showing a broad substrate profile similar to most B3 MBLs (30).…”

Triton Hodge Test: Improved Protocol for Modified Hodge Test for Enhanced Detection of NDM and Other Carbapenemase Producers

“…All PCRs were carried out using Platinum Pfx DNA polymerase (Invitrogen) with the following thermal cycle: 3 min at 95°C, 30 cycles of 15 s at 95°C, 30 s at 55°C, and 1 min at 68°C, and 10 min at 68°C. The NDM-1 C26A mutant gene was generated from pMBLe-bla NDM-1 by site-directed mutagenesis, as described previously (12), using the primers NDM-1-C26A Fw (5=-CATTGATGCTGAGCGGGGCGATGCCCGGTGAAATC-3=) and NDM-1-C26A Rv (5=-GATTTCACCGGGCATCGCCCCGCTCAGCA TCAATG-3=). V-NDM-1 and N-VIM-2 were constructed by overlapextension PCR using the overlapping primers VIM2-B (5=-ATTC GGTGCGAGCTGGCGGAAAACCAGATCCCCGACCGGAATTTC GC-3=), NDM1-C (5=-GATCTGGTTTTCCGCCCAGCTCGCAC CG-3=), NDM1-D (5=-ACCATCGGCAATCTGGTAAAGCCGGACCT CGCCAAACCGTTGGTCGCC-3=), and VIM2-E (5=-GAGGTCCGGC TTTACCAGATTGCCG-3=), with external primers VIM2NdeI Fw , NDM1NdeI Fw , VIM2StHindIII Rv , and NDM1StHindIII Rv .…”