<i>Ralstonia solanacearum</i> type III effector RipAS associates with potato type one protein phosphatase StTOPP6 to promote bacterial wilt

Wang, Bingsen; He, Wenfeng; Huang, Mengshu; Feng, Jiachen; Li, Yanping; Liu, Yu; Wang, Yuqi; Zhou, Dan; Meng, Chengzhen; Cheng, Dong; Song, Baoxing; Chen, Huilan

doi:10.1093/hr/uhad087

Cited by 5 publications

(2 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The constructs for N. benthamiana transformation were prepared using the pH7C vector (Wang, He, et al., 2023), which contains a gene for eGFP driven by the 35S promoter. Gene‐specific primers for OfPPO2 amplification are listed in Table S5.…”

Section: Methodsmentioning

confidence: 99%

Functional characterization of polyphenol oxidase OfPPO2 supports its involvement in parallel biosynthetic pathways of acteoside

Liu,

Han,

Zhao

et al. 2024

The Plant Journal

View full text Add to dashboard Cite

SUMMARYActeoside is a bioactive phenylethanoid glycoside widely distributed throughout the plant kingdom. Because of its two catechol moieties, acteoside displays a variety of beneficial activities. The biosynthetic pathway of acteoside has been largely elucidated, but the assembly logic of two catechol moieties in acteoside remains unclear. Here, we identified a novel polyphenol oxidase OfPPO2 from Osmanthus fragrans, which could hydroxylate various monophenolic substrates, including tyrosine, tyrosol, tyramine, 4‐hydroxyphenylacetaldehyde, salidroside, and osmanthuside A, leading to the formation of corresponding catechol‐containing intermediates for acteoside biosynthesis. OfPPO2 could also convert osmanthuside B into acteoside, creating catechol moieties directly via post‐modification of the acteoside skeleton. The reverse transcription‐quantitative polymerase chain reaction (RT‐qPCR) analysis and subcellular localization assay further support the involvement of OfPPO2 in acteoside biosynthesis in planta. These findings suggest that the biosynthesis of acteoside in O. fragrans may follow “parallel routes” rather than the conventionally considered linear route. In support of this hypothesis, the glycosyltransferase OfUGT and the acyltransferase OfAT could direct the flux of diphenolic intermediates generated by OfPPO2 into acteoside. Significantly, OfPPO2 and its orthologs constitute a functionally conserved enzyme family that evolved independently from other known biosynthetic enzymes of acteoside, implying that the substrate promiscuity of this PPO family may offer acteoside‐producing plants alternative ways to synthesize acteoside. Overall, this work expands our understanding of parallel pathways plants may employ to efficiently synthesize acteoside, a strategy that may contribute to plants' adaptation to environmental challenges.

show abstract

Section: Methodsmentioning

confidence: 99%

Functional characterization of polyphenol oxidase OfPPO2 supports its involvement in parallel biosynthetic pathways of acteoside

Liu,

Han,

Zhao

et al. 2024

The Plant Journal

View full text Add to dashboard Cite

show abstract

“…The qRT-PCR was performed on a LightCycler 480 II (Roche, Basel, Switzerland) with EvaGreen 2×qPCR MasterMix (ABM, http://www.abmgood.com (accessed on 5 December 2023)). In each case, PCR conditions were 95 • C for 15 min, followed by 40 cycles of 95 • C for 15 s, 60 • C for 30 s, and 72 • C for 30 s, as described previously [51]. The R. solanacearum flagellin (fliC) gene was used as a marker gene to normalize the bacterial population, and the standard curve between the Ct value of the fliC (F: GCTGTGGAATCCAACAACGG; R: GTTGGCGTTGGTTTCGATGT) and the population of the bacterial solution was calculated.…”

Section: Bacteria Dna Extraction and Qrt-pcrmentioning

confidence: 99%

Screening for Resistance Resources against Bacterial Wilt in Wild Potato

He,

Wang,

Huang

et al. 2024

Plants

Self Cite

View full text Add to dashboard Cite

Potato is an important crop, used not only for food production but also for various industrial applications. With the introduction of the potato as a staple food strategy, the potato industry in China has grown rapidly. However, issues related to bacterial wilt, exacerbated by factors such as seed potato transportation and continuous cropping, have become increasingly severe in the primary potato cultivation regions of China, leading to significant economic losses. The extensive genetic diversity of Ralstonia solanacearum (R. solanacearum), which is the pathogen of bacterial wilt, has led to a lack of highly resistant potato genetic resources. There is a need to identify and cultivate potato varieties with enhanced resistance to reduce the adverse impact of this disease on the industry. We screened 55 accessions of nine different wild potato species against the bacterial wilt pathogen R. solanacearum PO2-1, which was isolated from native potato plants and belongs to phylotype II. Three accessions of two species (ACL24-2, PNT880-3, and PNT204-23) were identified with high resistance phenotypes to the tested strains. We found these accessions also showed high resistance to different phylotype strains. Among them, only PNT880-3 was capable of flowering and possessed viable pollen, and it was diploid. Consistent with the high resistance, decreased growth of R. solanacearum was detected in PNT880-3. All these findings in our study reveal that the wild potato PNT880-3 was a valuable resistance source to bacterial wilt with breeding potential.

show abstract

Nucleolar actions in plant development and stress responses

Lee,

Seo,

Choi

et al. 2024

Plant Cell & Environment

View full text Add to dashboard Cite

The nucleolus is conventionally acknowledged for its role in ribosomal RNA (rRNA) synthesis and ribosome biogenesis. Recent research has revealed its multifaceted involvement in plant biology, encompassing regulation of the cell cycle, development, and responses to environmental stresses. This comprehensive review explores the diverse roles of the nucleolus in plant growth and responses to environmental stresses. The introduction delves into its traditional functions in rRNA synthesis and potential participation in nuclear liquid–liquid phase separation. By examining the multifaceted roles of nucleolar proteins in plant development, we highlight the impacts of various nucleolar mutants on growth, development, and embryogenesis. Additionally, we reviewed the involvement of nucleoli in responses to abiotic and biotic stresses. Under abiotic stress conditions, the nucleolar structure undergoes morphological changes. In the context of biotic stress, the nucleolus emerges as a common target for effectors of pathogens for manipulation of host immunity to enhance pathogenicity. The detailed exploration of how pathogens interact with nucleoli and manipulate host responses provides valuable insights into plant stress responses as well as plant growth and development. Understanding these processes may pave the way for promising strategies to enhance crop resilience and mitigate the impact of biotic and abiotic stresses in agricultural systems.

show abstract

Ralstonia solanacearum type III effector RipAS associates with potato type one protein phosphatase StTOPP6 to promote bacterial wilt

Cited by 5 publications

References 37 publications

Functional characterization of polyphenol oxidase OfPPO2 supports its involvement in parallel biosynthetic pathways of acteoside

Functional characterization of polyphenol oxidase OfPPO2 supports its involvement in parallel biosynthetic pathways of acteoside

Screening for Resistance Resources against Bacterial Wilt in Wild Potato

Nucleolar actions in plant development and stress responses

Contact Info

Product

Resources

About