CaWRKY58, encoding a groupI WRKYtranscription factor ofCapsicum annuum, negatively regulates resistance toRalstonia solanacearuminfection

Abstract

WRKY transcription factors are encoded by large gene families across the plant kingdom. So far, their biological and molecular functions in nonmodel plants, including pepper (Capsicum annuum) and other Solanaceae, remain poorly understood. Here, we report on the functional characterization of a new group I WRKY protein from pepper, termed CaWRKY58. Our data indicate that CaWRKY58 can be localized to the nucleus and can activate the transcription of the reporter β-glucuronidase (GUS) gene driven by the 35S core promoter with two copies of the W-box in its proximal upstream region. In pepper plants infected with the bacterial pathogen Ralstonia solanacearum, CaWRKY58 transcript levels showed a biphasic response, manifested in an early/transient down-regulation and late up-regulation. CaWRKY58 transcripts were suppressed by treatment with methyl jasmonate and abscisic acid. Tobacco plants overexpressing CaWRKY58 did not show any obvious morphological phenotypes, but exhibited disease symptoms of greater severity than did wild-type plants. The enhanced susceptibility of CaWRKY58-overexpressing tobacco plants correlated with the decreased expression of hypersensitive response marker genes, as well as various defence-associated genes. Consistently, CaWRKY58 pepper plants silenced by virus-induced gene silencing (VIGS) displayed enhanced resistance to the highly virulent R. solanacearum strain FJC100301, and this was correlated with enhanced transcripts of defence-related pepper genes. Our results suggest that CaWRKY58 acts as a transcriptional activator of negative regulators in the resistance of pepper to R. solanacearum infection.

Putative WRKYs associated with regulation of fruit ripening revealed by detailed expression analysis of the WRKY gene family in pepper

“…We found that group I comprised nearly 25% of the total identified CaWRKYs. Of these, only two CaWRKY members have been functionally identified in disease resistance process (CaWRKY13/Ca02g003339 and CaWRKY45/Ca09g001251)5152. Although current studies attribute group I CaWRKYs to disease resistance, our results suggest that group I CaWRKYs play a more important and fundamental role than other groups in reproductive development, especially in ripening of pepper fruit.…”

Capsicum annuum transcription factor WRKYa positively regulates defense response upon TMV infection and is a substrate of CaMK1 and CaMK2

“…Recently, CaWRKY58 was characterized as a negative regulator and classified as a group I WRKY. CaWRKY58 contained five conserved SP clusters but did not have D-domain51. CaWRKY2, another group I member, was isolated as a pathogen-inducible transcription factor and contained D-domain and five SP clusters although functional study of CaWRKY2 was not carried out52.…”

ISR meets SAR outside: additive action of the endophyte Bacillus pumilus INR7 and the chemical inducer, benzothiadiazole, on induced resistance against bacterial spot in field-grown pepper

“…The expression of candidate priming genes was analyzed using the following primer pairs: 5 ′ -AGCCTGAAATAGAAGAAACGGAGATGGAGATGAGA-3 ′ ( CaTin1- F), 5 ′ - GGAACCAGAATTGGTTACTCATGGCTACCTGAAC-3 ′ ( CaTin1- R), 5 ′ -ACTTGCAATTATGATCCACC-3 ′ ( CaPR1 -F), 5 ′ -ACTCCAGTTACTGCACCATT-3 ′ ( CaPR1 -R), 5 ′ -AACTGGGATTTGAGAACTGCCAGC-3 ′ ( CaPR4 -F), and 5 ′ - ATCCAAGGTACATATAGAGCTTCC-3 ′ ( CaPR4 -R). As a loading control to ensure that equal amounts of RNA were used in each assay, we also analyzed CaActin using the primers 5 ′ - CACTGAAGCACCCTTGAACCC -3 ′ and 5 ′ - GAGACAACACCGCCTGAATAGC -3 ′ (Wang et al, 2013). Relative transcript quantification was calculated using the 2-ΔΔCT method and standard errors of mean values among replicates were calculated using Bio-Rad manager (version 2.1; Bio-Rad CFX Connect).…”