Streptococcus mutans yidC1 and yidC2 Impact Cell Envelope Biogenesis, the Biofilm Matrix, and Biofilm Biophysical Properties

Abstract

Proper envelope biogenesis of Streptococcus mutans, a biofilm-forming and dental caries-causing oral pathogen, requires two paralogs (yidC1 and yidC2) of the universally conserved YidC/Oxa1/Alb3 family of membrane integral chaperones and insertases. The deletion of either paralog attenuates virulence in vivo, but the mechanisms of disruption remain unclear. Here, we determined whether the deletion of yidC affects cell surface properties, extracellular glucan production, and/or the structural organization of the exopolysaccharide (EPS) matrix and biophysical properties of S. mutans biofilm. Compared to the wild type, the ΔyidC2 mutant lacked staining with fluorescent vancomycin at the division septum, while the ΔyidC1 mutant resembled the wild type. Additionally, the deletion of either yidC1 or yidC2 resulted in less insoluble glucan synthesis but produced more soluble glucans, especially at early and mid-exponential-growth phases. Alteration of glucan synthesis by both mutants yielded biofilms with less dry weight and insoluble EPS. In particular, the deletion of yidC2 resulted in a significant reduction in biofilm biomass and pronounced defects in the spatial organization of the EPS matrix, thus modifying the three-dimensional (3D) biofilm architecture. The defective biofilm harbored smaller bacterial clusters with high cell density and less surrounding EPS than those of the wild type, which was stiffer in compression yet more susceptible to removal by shear. Together, our results indicate that the elimination of either yidC paralog results in changes to the cell envelope and glucan production that ultimately disrupts biofilm development and EPS matrix structure/composition, thereby altering the physical properties of the biofilms and facilitating their removal. YidC proteins, therefore, represent potential therapeutic targets for cariogenic biofilm control. IMPORTANCE YidC proteins are membrane-localized chaperone insertases that are universally conserved in all bacteria and are traditionally studied in the context of membrane protein insertion and assembly. Both YidC paralogs of the cariogenic pathogen Streptococcus mutans are required for proper envelope biogenesis and full virulence, indicating that these proteins may also contribute to optimal biofilm formation in streptococci. Here, we show that the deletion of either yidC results in changes to the structure and physical properties of the EPS matrix produced by S. mutans, ultimately impairing optimal biofilm development, diminishing its mechanical stability, and facilitating its removal. Importantly, the universal conservation of bacterial yidC orthologs, combined with our findings, provide a rationale for YidC as a possible drug target for antibiofilm therapies.

Protein Interactomes Identify Distinct Pathways forStreptococcus mutansYidC1 and YidC2 Membrane Protein Insertases

“…These data are consistent with the identification of coupled transcription/translation in other bacteria, which may also integrate aspects of DNA replication [55-59]. Both YidC1 and YidC2 contribute to proper cell wall biosynthesis and cell morphology in S. mutans [9], thus capture of proteins in this category is consistent with previously described mutant phenotypes.…”

“…While YidC1 and YidC2 apparently substitute for one another in some cases, distinct functional activities have been identified. YidC1 impacts cell surface biogenesis and bacterial adhesion more than YidC2, while YidC2 impacts cell wall biosynthesis and localization of penicillin binding proteins to the division septum [9, 10]. YidC1 and YidC2 demonstrate 27% amino acid homology and 48% similarity, each having six predicted transmembrane (TM) domains in the preprotein, and five in the mature insertase (TM2-TM6).…”

The extracellular DNA lattice of bacterial biofilms is structurally related to Holliday junction recombination intermediates

“…Herein, we also analyzed the mechanical properties of NTHI biofilms using axial indentation. All analyzed NTHI biofilms displayed a J-shaped stress-strain response, which has been observed for S. mutans (40,41) (48). Although the binding preference of each of these HJ DNA binding proteins are different, the fact that RuvA complemented the loss of DNABII proteins implied that the eDNA lattice within bacterial biofilms was comprised of a structure sufficiently similar to a bona fide HJ that complementation was possible.…”

Membrane proteomic analysis reveals overlapping and independent functions of Streptococcus mutans Ffh, YidC1, and YidC2

“…Three colonies each of wild‐type UA159 and a newly made ∆yidC2 mutant (Palmer et al, ) were picked from agar plates, inoculated into individual BHI broth cultures, grown for 24 hr (p1), then diluted 1:100 into fresh pre‐warmed BHI media every 24 hr for a total of 3 cycles (p2–p4). OD at 600 nm was determined at each passage, and aliquots were streaked onto agar plates, or pelleted and resuspended in BHI, 25% glycerol and frozen at −80°C for later use.…”

“…A third 509 bp product, beginning immediately after the stop codon of yidC1 and containing part of jag , was amplified using primers FWD‐KW03 (GGTGGAAACGGAGAACAAATCATGGTATTATT) and REV‐KW03 (ATCAACTTCATCAAATGCATCAGC). The three PCR fragments contained overlapping sequences engineered into the primers and were combined by splice overlap extension PCR using FWD‐KW01 and REV‐KW03 as previously described (Palmer et al, ). The final 1.8 kb product was cleaned and used to transform wild‐type S. mutans strain UA159 with selection of transformants on spectinomycin agar plates.…”