Identification and functional characterization of mRNAs that exhibit stop codon readthrough in Arabidopsis thaliana

Sahoo, Sarthak; Singh, Divyoj; Singh, Anumeha; Pandit, Madhuparna; Vasu, Kirtana; Som, Saubhik; Pullagurla, Naga Jyothi; Laha, Debabrata; Eswarappa, Sandeep M

doi:10.1016/j.jbc.2022.102173

Cited by 12 publications

(16 citation statements)

References 51 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…SCR, classified as the recoding of stop codons, is a regulatory mode of translation that could produce multiple protein isoforms from the same transcript 1,54 38 . However, a systematic study of SCR events in plants at the protein level is still lacking.…”

Section: Discussionmentioning

confidence: 99%

“…The coding sequences of the tested genes, ZmH3C2, ZmCEQORH, ZmBTF3 and Zm00001d009138, along with their canonical stop codons and inter-stop codon regions (ISRs, the extension regions) were cloned upstream of the coding sequence of the firefly luciferase gene (Fluc) without ATG between EcoRI and KpnI sites. A linker sequence (5′ GGCGGCTCCGGCGGCTCCCTCGTGCTCGGG 3′) was added upstream of the Fluc sequence to avoid potential distortions between the tested protein and Fluc in the fusion protein 15,31,38 For subcellular localization analysis, the ZmBTF3 and ZmBTF3x coding sequences were introduced into the pAN580 vector containing the 35S promoter and the coding sequence for GFP. GFP was fused to the C-terminus of ZmBTF3 and ZmBTF3x.…”

Section: Plasmid Constructionmentioning

confidence: 99%

“…20.533458 doi: bioRxiv preprint mammals, Hemoglobin beta chain (HBB) 28 , Myelin protein zero (MPZ) 29 , Vascular endothelial growth factor-A (VEGF-A) 15 , Mitochondrial carrier 2 (MTCH2) 30 , Argonaute 1 (AGO1) 31 , Opioid related nociceptin receptor 1 (OPRL1) 32 , Mitogenactivated protein kinase 10 (MAPK10) 32 , Aquaporin 4 (AQP4) 33 , Lactate dehydrogenase B (LDHB) 34 , Malate dehydrogenase 1 (MDH1) 34 , Vitamin D receptor (VDR) 35 , and Adenosylmethionine decarboxylase 1 (AMD1) 36,37 have been confirmed to undergo readthrough. However, SCR events in plants remain largely uncharacterized, with only one study reporting 144 readthrough genes in Arabidopsis detected with ribosome profiling 38 . Therefore, further exploration of SCR events with a more robust analysis is warranted in a wide range of plant species.…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Widespread readthrough events in plants reveal unprecedented plasticity of stop codons

Tian

et al. 2023

Preprint

View full text Add to dashboard Cite

Stop codon readthrough (SCR), the decoding of a stop codon as a sense codon by the ribosome, has important biological implications but remains largely uncharacterized in plants. Here, we identified 1,009 SCR events in two monocots (maize, rice) and two dicots (soybean, Arabidopsis) using a proteogenomic strategy with 80 customized databases. SCR transcripts were mostly significantly shorter and had fewer components than non-SCR transcripts in two monocot plants, although these differences were not as significant in the dicots. Mass spectrometry evidence revealed that all three stop codons involved in SCR events could be recoded as 20 standard amino acids, some of which were also supported by suppressor transfer RNA analysis. In addition, we observed multiple functional signals in the C-terminal extensions of 34 maize SCR proteins, and characterized the structural and subcellular localization changes in the extended protein of BASIC TRANSCRIPTION FACTOR 3. Overall, our study not only demonstrates that SCR events are widespread in plants but also reveals the unprecedented recoding plasticity of stop codons, which provides important new insights into the flexibility of genetic decoding.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Plasmid Constructionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Widespread readthrough events in plants reveal unprecedented plasticity of stop codons

Tian

et al. 2023

Preprint

View full text Add to dashboard Cite

show abstract

“…Some of these elements include complex, higher-order RNA secondary structures (e.g., stem-loops) [ 23 ]. Although most prevalent in viral genomes, there is evidence for physiological readthrough of normal stop codons in a growing number of organisms, including bacteria, yeast, insects, humans and, most recently, in Arabidopsis thaliana [ 20 , 21 , 26 , 27 , 28 , 29 ]. Using ribosome-profiling data, evidence for stop codon readthrough was found in 144 A. thaliana genes [ 29 ].…”

Section: Molecular Mechanisms Of Translation Termination and Nonsense...mentioning

confidence: 99%

“…Although most prevalent in viral genomes, there is evidence for physiological readthrough of normal stop codons in a growing number of organisms, including bacteria, yeast, insects, humans and, most recently, in Arabidopsis thaliana [ 20 , 21 , 26 , 27 , 28 , 29 ]. Using ribosome-profiling data, evidence for stop codon readthrough was found in 144 A. thaliana genes [ 29 ]. Constituting an important expansion of the proteome, the C-terminally extended isoforms often contained putative nuclear localization signals or transmembrane helices that influence the function, localization and stability of the respective proteins [ 28 , 30 ].…”

Section: Molecular Mechanisms Of Translation Termination and Nonsense...mentioning

confidence: 99%

Emerging Personalized Opportunities for Enhancing Translational Readthrough in Rare Genetic Diseases and Beyond

Wagner

Wießner

Friedrich

et al. 2023

IJMS

View full text Add to dashboard Cite

Nonsense mutations trigger premature translation termination and often give rise to prevalent and rare genetic diseases. Consequently, the pharmacological suppression of an unscheduled stop codon represents an attractive treatment option and is of high clinical relevance. At the molecular level, the ability of the ribosome to continue translation past a stop codon is designated stop codon readthrough (SCR). SCR of disease-causing premature termination codons (PTCs) is minimal but small molecule interventions, such as treatment with aminoglycoside antibiotics, can enhance its frequency. In this review, we summarize the current understanding of translation termination (both at PTCs and at cognate stop codons) and highlight recently discovered pathways that influence its fidelity. We describe the mechanisms involved in the recognition and readthrough of PTCs and report on SCR-inducing compounds currently explored in preclinical research and clinical trials. We conclude by reviewing the ongoing attempts of personalized nonsense suppression therapy in different disease contexts, including the genetic skin condition epidermolysis bullosa.

show abstract

Overlaps Between CDS Regions of Protein-Coding Genes in the Human Genome: A Case Study on the NR1D1-THRA Gene Pair

Bukhnikashvili

2023

J Mol Evol

View full text Add to dashboard Cite

Identification and functional characterization of mRNAs that exhibit stop codon readthrough in Arabidopsis thaliana

Cited by 12 publications

References 51 publications

Widespread readthrough events in plants reveal unprecedented plasticity of stop codons

Widespread readthrough events in plants reveal unprecedented plasticity of stop codons

Emerging Personalized Opportunities for Enhancing Translational Readthrough in Rare Genetic Diseases and Beyond

Overlaps Between CDS Regions of Protein-Coding Genes in the Human Genome: A Case Study on the NR1D1-THRA Gene Pair

Contact Info

Product

Resources

About