Identification and Virulence Characterization of Two Akanthomyces attenuatus Isolates Against Megalurothrips usitatus (Thysanoptera: Thripidae)

Abstract

Megalurothrips usitatus (Bagnall) is one of the most harmful pests of leguminous plants. In order to expand our knowledge on the infection of M. usitatus by entomopathogenic fungi, two newly identified isolates of Akanthomyces attenuatus (Zare & Gams) were tested for their pathogenicity against M. usitatus. Both isolates of A. attenuatus (SCAUDCL-38 and SCAUDCL-56) were isolated from soil and were identified by morphological and molecular analyses. The adult females of M. usitatus were treated with five different concentrations (1 × 104, 1 × 105, 1 × 106, 1 × 107, and 1 × 108 conidia/mL) of the isolates. Our results revealed 76.25% and 57.5% mortality of M. usitatus after five days of treatment with 1 × 108 conidia/mL of SCAUDCL-38 and SCAUDCL-56, respectively. The median lethal concentrations (LC50) of SCAUDCL-38 and SCAUDCL-56 calculated through linear regression analysis after five days of fungal treatment of M. usitatus were 1.9 × 106 and 1.5 × 107 conidia/mL, respectively, whereas the median lethal time (LT50) observed for 1 × 108 conidia/mL of SCAUDCL-38 and SCAUDCL-56 were 3.52 days and 4.9 days, respectively. A. attenuatus isolates SCAUDCL-38 and SCAUDCL-56 are highly pathogenic strains of M. usitatus. These findings offer valuable information on the development and commercialization of alternative control measures against M. usitatus.

Morphological and molecular identification of four Purpureocillium isolates and evaluating their efficacy against the sweet potato whitefly, Bemisia tabaci (Genn.) (Hemiptera: Aleyrodidae)

“…Collected samples were stored at 4°C. Fungi were isolated by the methods of Imoulan et al (2011) and Du et al (2019). Briefly, a mixture of soil sample (3 g) and 30 ml sterilized 0.05% Tween-80 solution in ddH 2 O was prepared by stirring for 15 min.…”

“…Morphological characters of 4 fungal isolates (XI-1, XI-4, XI-5, and J27) were studied through inoculating fungal mycelial plug (1 cm Ø) observed by culturing small fungal mycelia PDA block draped by a cover slip for 10 days (Imoulan et al 2011;Du et al 2019). The slides were stained by lactophenol cotton blue and were observed under a phase-contact microscope (×100).…”

“…The ITS primers (ITS4F: TCCTCCGCTTATTGATATGC; and ITS5R: GGAA GTAAAAGTCGTAACAAGG) reported by White et al (1990) were used to amplify ITS regions. The PCR cycling and conditions of Du et al (2019) were used for amplification of ITS regions. The purity of PCR products was observed through agarose gel electrophoresis, followed by GenGreen (TianGen Biotech, Beijing, China) staining.…”

“…During the past decade, the techniques employed for isolation and identification of EPF have evolved from morphological characterization to amplification of different DNA or RNA fragments through polymerase chain reactions improving the basic understanding about EPF (Canfora et al 2016). In recent years, molecular techniques have become widely used for identification of EPF as the genotypic identification methods (such as random amplified polymorphic DNA-polymerase chain reaction) are more precise than the morphological character-based identification (Du et al 2019).…”

Characterization and Toxicity of Crude Toxins Produced by Cordyceps fumosorosea against Bemisia tabaci (Gennadius) and Aphis craccivora (Koch)

“…In addition, the negative impacts of synthetic insecticides on beneficial insects [ 13 , 14 ] and humans have forced the agricultural industry to seek the development of bio-rational and natural/indigenous methods to control insect pests [ 15 ]. Therefore, the development and application of biochemicals/biopesticides originating from naturally occurring insect pathogenic fungi can potentially provide an alternative to synthetic insecticides [ 16 ].…”