Identification of a Leishmania infantum gene mediating resistance to ‘ and SbIII

Choudhury, Kohelia; Zander, Dorothea; Kube, Michael; Reinhardt, Richard; Clos, Joachim

doi:10.1016/j.ijpara.2008.03.005

Cited by 57 publications

(48 citation statements)

References 44 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The cosmid conferring the highest resistance level was derived from chromosome 23 and contains the well-known resistance gene MRPA (40) ( Table 1). Two other cosmids enriched through SbIII selection were derived from chromosomes 8 and 34 and contain the LinJ.08.0630 (P299) and LinJ.34.0220 (ARM58) genes, respectively, which have been implicated in SbIII resistance (43,44) (Table 1).…”

Section: High-throughput Screening Of the Five Major Antileishmanial mentioning

confidence: 99%

Cos-Seq for high-throughput identification of drug target and resistance mechanisms in the protozoan parasite Leishmania

Gazanion

Fernández-Prada

Papadopoulou

et al. 2016

Proc. Natl. Acad. Sci. U.S.A.

106

View full text Add to dashboard Cite

Innovative strategies are needed to accelerate the identification of antimicrobial drug targets and resistance mechanisms. Here we develop a sensitive method, which we term Cosmid Sequencing (or "Cos-Seq"), based on functional cloning coupled to next-generation sequencing. Cos-Seq identified >60 loci in the Leishmania genome that were enriched via drug selection with methotrexate and five major antileishmanials (antimony, miltefosine, paromomycin, amphotericin B, and pentamidine). Functional validation highlighted both known and previously unidentified drug targets and resistance genes, including novel roles for phosphatases in resistance to methotrexate and antimony, for ergosterol and phospholipid metabolism genes in resistance to miltefosine, and for hypothetical proteins in resistance to paromomycin, amphothericin B, and pentamidine. Several genes/loci were also found to confer resistance to two or more antileishmanials. This screening method will expedite the discovery of drug targets and resistance mechanisms and is easily adaptable to other microorganisms.

show abstract

Section: High-throughput Screening Of the Five Major Antileishmanial mentioning

confidence: 99%

Cos-Seq for high-throughput identification of drug target and resistance mechanisms in the protozoan parasite Leishmania

Gazanion

Fernández-Prada

Papadopoulou

et al. 2016

Proc. Natl. Acad. Sci. U.S.A.

106

View full text Add to dashboard Cite

show abstract

“…infantum promastigotes were transfected with the DNA from an L. infantum gDNA cosmid library (16). The recombinant population was split and subjected to selection in duplicate with Sb III , As III , Cu 2ϩ , Cd 2ϩ , and miltefosine at the respective growthinhibiting IC 50 .…”

Section: (D) Ultrastructure Of the Flagellar Pocket Of L Donovani Prmentioning

confidence: 99%

“…Sb V resistance mechanisms include (i) the downregulation of uptake transporters, such as AQP1 (7)(8)(9); (ii) the upregulation of ABC transporters, such as the P-glycoprotein MRPA in Leishmania (10,11) or in macrophages (12); and (iii) the production of increased levels of trypanothione for the efflux or sequestration of Sb III (13,14). An analysis of resistance marker expression in clinical isolates of Leishmania infantum from the Mediterranean Basin showed diverse patterns of expression and coexpression of the above-mentioned resistance genes and several others (15); among these are the Sb III /miltefosine resistance gene P299, which was identified by functional cloning from a L. infantum genomic DNA (gDNA) cosmid library under miltefosine selection (16).…”

mentioning

confidence: 99%

See 1 more Smart Citation

A Telomeric Cluster of Antimony Resistance Genes on Chromosome 34 of Leishmania infantum

Nevado

Bifeld

Höhn

et al. 2016

Antimicrob Agents Chemother

Self Cite

View full text Add to dashboard Cite

The mechanisms underlying the drug resistance of Leishmania spp. are manifold and not completely identified. Apart from the highly conserved multidrug resistance gene family known from higher eukaryotes, Leishmania spp. also possess genus-specific resistance marker genes. One of them, ARM58, was first identified in Leishmania braziliensis using a functional cloning approach, and its domain structure was characterized in L. infantum. Here we report that L. infantum ARM58 is part of a gene cluster at the telomeric end of chromosome 34 also comprising the neighboring genes ARM56 and HSP23. We show that overexpression of all three genes can confer antimony resistance to intracellular amastigotes. Upon overexpression in L. donovani, ARM58 and ARM56 are secreted via exosomes, suggesting a scavenger/secretion mechanism of action. Using a combination of functional cloning and next-generation sequencing, we found that the gene cluster was selected only under antimonyl tartrate challenge and weakly under Cu 2؉ challenge but not under sodium arsenite, Cd 2؉ , or miltefosine challenge. The selective advantage is less pronounced in intracellular amastigotes treated with the sodium stibogluconate, possibly due to the known macrophage-stimulatory activity of this drug, against which these resistance markers may not be active. Our data point to the specificity of these three genes for antimony resistance. P arasitic protozoa of the genus Leishmania, order Trypanosomatida, are responsible for the various clinical manifestations of leishmaniasis. The disease is transmitted by the bite of sandflies, with 2 million new infections occurring per year, and occurs in 98 countries on five continents (1). Leishmania spp. exist in two morphologically distinct life cycle stages. In the transmitting sandflies, the flagellated and elongated promastigotes proliferate attached to the epithelium of the digestive tract until they reach a high density. A switch in the surface molecule composition then causes detachment, and the so-called metacyclic promastigotes are free to invade a mammalian host when the sandfly takes a blood meal. Inside the mammalian skin, the parasites are quickly taken up by antigen-presenting cells, such as dendritic cells, neutrophilic granulocytes, and macrophages, and establish themselves in these cells as small, ovoid, aflagellated amastigotes. The resulting destruction of infected macrophages causes inflammatory immune responses and the concomitant immune pathologies.Depending on the infecting species and on the host's immune status, Leishmania-related pathologies range from localized, ulcerating skin lesions (cutaneous leishmaniasis [CL]) and diffuse cutaneous lesion formation (diffuse cutaneous leishmaniasis [DCL]) to mucocutaneous leishmaniasis (MCL) and, lastly, a generalized infection known as kala azar (visceral leishmaniasis [VL]). VL is invariably lethal in untreated cases, while MCL can also have lethal outcomes due to secondary infections of the nasopharyngeal area.As there is no vaccine against Leishmania a...

show abstract

“…Semiquantitative real-time reverse transcription polymerase chain reaction (RT-PCR) was performed essentially as described (Choudhury et al 2008). SGT-specific primers were SGT-fwd (TGGGAACGGCTCTCTTCTACCAGG) and SGT-rev (TTGTGGGTGGCATTGTCGGG).…”

Section: Expression Profilingmentioning

confidence: 99%

The co-chaperone SGT of Leishmania donovani is essential for the parasite's viability

Ommen

Chrobak

Clos

2010

Cell Stress and Chaperones

Self Cite

View full text Add to dashboard Cite

Molecular chaperone proteins play a pivotal role in the protozoan parasite Leishmania donovani, controlling cell fate and ensuring intracellular survival. In higher eukaryotes, the so-called co-chaperone proteins are required for client protein recognition and proper function of chaperones, among them the small glutamine-rich tetratricopeptide repeat proteins (SGT) which interact with both HSP70 and HSP90 chaperones. An atypical SGT homolog is found in the L. donovani genome, encoding a protein lacking the C-terminal glutamine-rich region, normally typical for SGT family members. The gene is expressed constitutively during the life cycle and is essential for survival and/or growth of the parasites. LdSGT forms large, stable complexes that also include another putative cochaperone, HSC70 interacting protein (HIP). The gene product forms cytoplasmic clusters, matching the subcellular distribution of HIP and partly that of the major cytoplasmic chaperones, HSP70 and HSP90, reflecting a direct molecular interaction with both chaperones.

show abstract

Identification of a Leishmania infantum gene mediating resistance to ‘ and SbIII

Cited by 57 publications

References 44 publications

Cos-Seq for high-throughput identification of drug target and resistance mechanisms in the protozoan parasite Leishmania

Cos-Seq for high-throughput identification of drug target and resistance mechanisms in the protozoan parasite Leishmania

A Telomeric Cluster of Antimony Resistance Genes on Chromosome 34 of Leishmania infantum

The co-chaperone SGT of Leishmania donovani is essential for the parasite's viability

Contact Info

Product

Resources

About