Identification of a Short Viral Transcript in Leishmania RNA Virus-infected Cells

Chung, In Kwon; Armstrong, Timothy Currie

doi:10.1006/viro.1994.1066

Cited by 13 publications

(11 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Native virions were purified as described (11). Briefly, Leishmania promastigotes (-1010 cells) were harvested in early stationary phase, washed, and lysed in 1% Triton X-100.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Single-site cleavage in the 5'-untranslated region of Leishmaniavirus RNA is mediated by the viral capsid protein.

MacBeth¹

1995

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

Leishmaniavirus (LRV) is a double-stranded RNA virus that persistently infects the protozoan parasite Leishmania. LRV produces a short RNA transcript, corresponding to the 5' end of positive-sense viral RNA, both in vivo and in in vitro polymerase assays. The short transcript is generated by a single site-specific cleavage event in the 5' untranslated region of the 5. The initial search for viruses in the protozoan parasite Leishmania was undertaken for the potential power these organisms might provide as molecular tools in probing the host-cell biology and as model viral systems (1). Leishmaniaviruses (LRVs) have now been identified in twelve strains of Leishmania braziliensis or Leishmania guyanensis (2) and one strain of Leishmania major (3). Much interest has developed over the role that this virus may play in the virulence and pathogenesis of leishmaniasis. There is a precedent in simple eukaryotes for double-stranded RNA (dsRNA) viruses playing a role in pathogenesis. The dsRNA virus that infects the Chestnut Blight fungus has been shown to confer hypovirulence to this fungus (4). Although the effect that LRV may have on the growth or virulence of Leishmania remains to be elucidated, much has been learned about the virus itself.LRV is a dsRNA virus that persistently infects some strains of the protozoan parasite Leishmania (5). The complete sequences and genome organization for two LRV isolates from the New World protozoan strain L. guyanensis have been reported (6, 7). The virus genome is -5280 nt in length, and two large open reading frames (ORFs) are present in both isolates. When ORF2 was expressed in a recombinant baculovirus expression system, the expressed protein selfassembled into virus-like particles. The protein reacted to antiserum generated against purified virus, demonstrating that ORF2 encoded the 82-kDa capsid protein (8). ORF3 is believed to encode the viral polymerase, as the predicted protein product of ORF3 possesses motifs characteristic of viral RNA-dependent RNA polymerases (9). In an in vitro polymerase assay, both double-and single-stranded RNAs are synthesized by purified virions, indicating that the viral polymerase possesses both replicase and transcriptase activities (10).In addition to genome-length RNA transcripts, a short transcript corresponding to the 5' end of viral positive-sense RNA is generated in polymerase assays of purified virions (11). This short transcript is also detected in infected cells by Northern blot analysis. We have recently shown that the short transcript of LRV1-4 is generated by cleavage within the 5' untranslated region of viral RNA transcripts (12). The endonuclease activity responsible for the cleavage event was proteinaceous in nature and was only associated with intact viral particles. In this report, we identify the viral capsid protein as the responsible endonuclease by demonstrating that recombinant-expressed viral capsid protein possesses the endoribonuclease activity. Furthermore, a region of nucleotides at the cleavage site is requ...

show abstract

“…Native virions were purified as described (11). Briefly, Leishmania promastigotes (-1010 cells) were harvested in early stationary phase, washed, and lysed in 1% Triton X-100.…”

Section: Methodsmentioning

confidence: 99%

“…In addition to genome-length RNA transcripts, a short transcript corresponding to the 5' end of viral positive-sense RNA is generated in polymerase assays of purified virions (11). This short transcript is also detected in infected cells by Northern blot analysis.…”

mentioning

confidence: 99%

Single-site cleavage in the 5'-untranslated region of Leishmaniavirus RNA is mediated by the viral capsid protein.

MacBeth¹

1995

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

show abstract

“…Complementary DNAs were made from these heat-denatured RNAs or native RNAs with SuperscriptII reverse transcriptase (Gibco-BRL) at 53°C using template-specific oligonucleotides as primers, which had sequences and positions within the OSV dsRNA as follows: primer c1 (TGGGA-AAACACCTGAAGTTG, nt 13,673-13,691) and primer nc1 (CTCAATCGTTCATCATCTGG, nt 419-438), Primers for PCR reactions were as follows: primer cl, primer c2 (ATGAATTCCGTAC-ACTGGTACAATTATC, nt 13,721-13,748), primer nc3 (CCTGTTGTTGCTGCGTTCA, nt [38][39][40][41][42][43][44][45][46][47][48][49][50][51][52][53][54][55][56][57] …”

Section: Reverse Transcription (Rt)-pcrmentioning

confidence: 99%

Putative Replication Intermediates in Endornavirus, a Novel Genus of Plant dsRNA Viruses

Horiuchi

Fukuhara

2004

Virus Genes

View full text Add to dashboard Cite

Oryza sativa endornavirus (OSV) belongs to a new genus (Endornavirus) and family (Endoviridae) with members containing large double-stranded RNA (dsRNA) replicons with plasmid-like properties. Analysis of products obtained from in vitro reaction of the OSV RNA-dependent RNA polymerase revealed a rapid increase of a population of the non-coding strand RNA molecules with a head-to-tail composition. Northern hybridization of total RNA from OSV-carrier cells with riboprobes specific for the coding strand RNA, revealed two types of RNA molecules (i) with a site specific nick and (ii) full-length unnicked molecules. Quantitative analyses of these RNAs showed about 50-fold higher amounts of full-length unnicked molecules in cultured cells in which the OSV copy number increases compared with those found in the seedling cells. Both the head-to-tail linked non-coding strand and the full-length coding strand molecules were also found in wild rice and broad beans infected with other endornaviruses indicating that the presence of these unique types of RNA molecules should be considered as a characteristic feature of Endoviridae .

show abstract

“…Leishmaniavirus virions were purified as previously described (8). Briefly, Leishmania promastigotes (ϳ10 10 cells) were harvested in early stationary phase, washed, and lysed in 1% Triton X-100.…”

Section: Methodsmentioning

confidence: 99%

“…(8), studies have focused on understanding the nature of this transcript and mapping the precise cleavage site on the full-length RNA substrate. The cleavage site in LRV1-4 RNA was mapped by primer extension (19) to nucleotide 320 of the virus 5Ј untranslated region (UTR).…”

mentioning

confidence: 99%

Identification of the Minimal Essential RNA Sequences Responsible for Site-Specific Targeting of the Leishmania RNA Virus 1-4 Capsid Endoribonuclease

2000

J Virol

Self Cite

View full text Add to dashboard Cite

The Leishmania RNA virus 1-4 capsid protein possesses an endoribonuclease activity responsible for single-site-specific cleavage within the 450-nucleotide 5 untranslated region of its own viral RNA transcript. To characterize the minimal essential RNA determinants required for site-specific cleavage, mutated RNA transcripts were examined for susceptibility to cleavage by the virus capsid protein in an in vitro assay. Deletion analyses revealed that all determinants necessary for accurate cleavage are encoded in viral nucleotides 249 to 342. Nuclease mapping and site-specific mutagenesis of the minimal RNA sequence defined a stem-loop structure that is located 40 nucleotides upstream from the cleavage site (nucleotide 320) and that is essential for accurate RNA cleavage. Abrogation of cleavage by disruption of base pairing within the stem-loop was reversed through the introduction of complementary nucleotide substitutions that reestablished the structure. We also provide evidence that divalent cations, essential components of the cleavage reaction, stabilized the stem-loop structure in solution. That capsid-specific antiserum eliminated specific RNA cleavage provides further evidence that the virus capsid gene encodes the essential endoribonuclease activity.The Leishmania RNA virus (LRV) genome comprises approximately 5.3 kb of double-stranded RNA that encodes two large open reading frames (ORF2 and ORF3) on the positivesense strand in all isolates examined (31,32,35). When expressed by recombinant baculovirus in Spodoptera frugiperda 9 (Sf9) cells, the product of LRV1-4 ORF2 self-assembles into virus-like particles morphologically identical to native virions, demonstrating that ORF2 encodes the major capsid protein (5). Sequence similarities to the RNA-dependent RNA polymerases of other double-stranded and plus-strand RNA viruses further imply that ORF3 encodes the viral RNA-dependent RNA polymerases.Since a short RNA transcript was first identified, both as a product of an in vitro polymerase assay and as a by-product of natural virus infection in Leishmania spp. (8), studies have focused on understanding the nature of this transcript and mapping the precise cleavage site on the full-length RNA substrate. The cleavage site in LRV1-4 RNA was mapped by primer extension (19) to nucleotide 320 of the virus 5Ј untranslated region (UTR). Subsequent gene expression studies identified the LRV1-4 capsid protein as the endoribonuclease responsible for the cleavage event (see references 20 and 21 for a review). As with many other endoribonucleases (10, 11), divalent cations have been shown to be essential for RNA cleavage in LRV (19), although their precise role has not been identified. The original RNA substrate developed for use in the in vitro cleavage assay contains 447 nucleotides derived from the 5Ј UTR of a full-length LRV1-4 transcript (19). Crude boundary mapping subsequently identified a 226-nucleotide RNA fragment that retains all determinants necessary to accurately target cleavage to the wild-type site (18).S...

show abstract

Identification of a Short Viral Transcript in Leishmania RNA Virus-infected Cells

Cited by 13 publications

References 0 publications

Single-site cleavage in the 5'-untranslated region of Leishmaniavirus RNA is mediated by the viral capsid protein.

Single-site cleavage in the 5'-untranslated region of Leishmaniavirus RNA is mediated by the viral capsid protein.

Putative Replication Intermediates in Endornavirus, a Novel Genus of Plant dsRNA Viruses

Identification of the Minimal Essential RNA Sequences Responsible for Site-Specific Targeting of the Leishmania RNA Virus 1-4 Capsid Endoribonuclease

Contact Info

Product

Resources

About