Identification of an Essential Domain in the Herpesvirus VP1/2 Tegument Protein: the Carboxy Terminus Directs Incorporation into Capsid Assemblons

Abstract

The herpesvirus tegument is a layer of viral and cellular proteins located between the capsid and envelope of the virion. The VP1/2 tegument protein is critical for the propagation of all herpesviruses examined. Using an infectious clone of the alphaherpesvirus pseudorabies virus, we have made a collection of truncation and in-frame deletion mutations within the VP1/2 gene (UL36) and examined the resulting viruses for spread between cells. We found that the majority of the VP1/2 protein either was essential for virus propagation or did not tolerate large deletions. A recently described amino-terminal deubiquitinase-encoding domain was dispensable for alphaherpesvirus propagation, but the rate of propagation in an epithelial cell line and the frequency of transport in axons of primary sensory neurons were both reduced. We mapped one essential domain to a conserved sequence at the VP1/2 carboxy terminus and demonstrated that this domain sufficient to redirect the green fluorescent protein to capsid assemblons in nuclei of infected cells.

Nuclear Egress of Pseudorabies Virus Capsids Is Enhanced by a Subspecies of the Large Tegument Protein That Is Lost upon Cytoplasmic Maturation

“…GFP-VP1/2 emissions from PRV-GS909 were diffusely distributed throughout the cytoplasm but were less evident in nuclei, consistent with previous reports (Fig. 2B) (39,49). In contrast, VP1/2-GFP emissions from PRV-GS1903 were enriched at the nuclear membrane.…”

“…Once C capsids leave the nucleus, domains of VP1/2 that are absent in the carboxyl fragment are essential to continue viral assembly in the cytoplasm and produce infectious virions (1,2,39,48). We infer that a near total replacement of carboxyl fragments with full-length VP1/2 occurs prior to cytoplasmic envelopment based on the VP1/2 composition of extracellular viral particles.…”

“…Upon completion of nuclear egress a switch between the nuclear and cytoplasmic forms of capsid-bound VP1/2 occurs, consistent with the requirement for domains in the full-length protein in virion morphogenesis and release from the cell (9,22,39,48).…”

“…To construct the VP1/2N expression plasmid, the R6K plasmid pGS1292 was amplified with the primers 5=CCAAATAAAAAGA TTTTTCCCCCACGCGCGTGTGTTATTTCAGCCGATTTTTATCGAA TTCGTCATCCATATCACCACG and 5=ACTGATTACGATAGCCGAC GACCACCGCGTCGGCCGTCAAAGCTTCCACATGTGGAATTCC CAT. Using RED recombination, the PCR product was inserted in front of the second codon of UL36 in a derivative of pBecker3 (pGS685) that was previously modified to encode a stop codon and a flippase recognition target (FRT) site as a combined 37-nucleotide (nt) insertion after codon 2018 of UL36 (38,39). The UL36 allele was liberated by digestion with BsaBI, which cut the sequence derived from the forward primer (in italics in the primer sequence) upstream of UL36 and an endogenous site downstream of UL36.…”

“…The monoclonal mouse antibody directed against PRV VP5 (clone 3C10) was provided by Lynn Enquist. Rabbit antiserum raised against a UL37 peptide has been previously described (39). To detect VP1/2 antigen, a rabbit polyclonal antibody was generated by immunization with the PRV VP1/2 peptide sequence CQPSQQRPPEAPWTWPEPRD.…”