Identification of an RNA aptamer binding hTERT-derived peptide and inhibiting telomerase activity in MCF7 cells

Varshney, Akhil; Bala, Jyoti; Santosh, Baby; Bhaskar, Ashima; Kumar, S. N.; Yadava, Pramod Kumar

doi:10.1007/s11010-016-2907-7

Cited by 16 publications

(10 citation statements)

References 48 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The present study and Ming's study showed the similar potential effects of combined β-escin and 5-FU to reduce Bcl-2 protein expression, cell proliferation, and inducing cell apoptosis in SMMC-7721 and MCF7 cells with respect to untreated control cells or single treatment of 5-FU and β-escin. SMMC-7721 and MCF7 have different tissue origin; however, they have some similar properties such as positive telomerase activity[2930] which may be influenced in their response to the effects of combined β-escin and 5-FU. [31] It seems that the combination of β-escin and 5-FU may be effective, at least partly, on other cancer cell lines in special ratio and concentration.…”

Section: Discussionmentioning

confidence: 99%

Activation of p53 gene expression and synergistic antiproliferative effects of 5-fluorouracil and β-escin on MCF7 cells

Mazrouei

Raeisi

Lemoigne³

et al. 2019

J Med Signals Sens

View full text Add to dashboard Cite

One of the most common malignancies in women is breast cancer. β-escin has pharmacological anticancer effects. 5-fluorouracil (5-FU) has antimetabolite and antiproliferative properties. The purpose of this study was to investigate the combined effects of 5-FU and β-escin on apoptosis, colony formation, Bcl-2 signaling protein, and p53 gene expression in MCF7 breast cancer cell line. The cytotoxic effects, the number of colonies, apoptosis, p53 gene expression, and Bcl-2 signaling protein of the combined 5-FU and β-escin on MCF7 cells were determined using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, clonogenic assay, flow cytometry, real-time quantitative polymerase chain reaction, and western blotting methods, respectively. Half-maximal inhibitory concentration values of β-escin and 5-FU were 80 μg/ml and 2 μM, respectively. The combination of 5-FU and β-escin on MCF7 cell viability showed a combination index equal to 0.5. The expression of p53 and apoptosis increased in the combination of 5-FU and β-escin on MCF7 cells compared to that of control group (P < 0.05). In addition, the number of colonies and Bcl-2 signaling protein in combination of 5-FU and β-escin decreased with respect to untreated control cells or single treatment of 5-FU and β-escin. The combination of 5-FU and β-escin not only has synergistic effects by increasing cell apoptosis and p53 gene expression but also decreases Bcl-2 signaling protein in MCF7 cell lines.

show abstract

Section: Discussionmentioning

confidence: 99%

Activation of p53 gene expression and synergistic antiproliferative effects of 5-fluorouracil and β-escin on MCF7 cells

Mazrouei

Raeisi

Lemoigne³

et al. 2019

J Med Signals Sens

View full text Add to dashboard Cite

show abstract

“…Inactivated aptazyme sensing hTERT included hTERT aptamer and hammerhead ribozyme. The sequence of hTERT aptamer or hammerhead ribozyme was shown in the previous studies (Chen et al, 2010;Varshney et al, 2017). The sequence of hTERT aptamer is 5'-AGACAAGAAUAAAACGCUCAAUAUUGG GCUUUUAGCUUCUUGGUUGGAUAAUAGAUACACAUU CGACAGGAGGCUCACAACAGGC-3'.…”

Section: Vector Constructionmentioning

confidence: 92%

Engineered CRISPR/Cas13d Sensing hTERT Selectively Inhibits the Progression of Bladder Cancer In Vitro

Zhuang

Zhou

et al. 2021

Front. Mol. Biosci.

View full text Add to dashboard Cite

Aptazyme and CRISPR/Cas gene editing system were widely used for regulating gene expression in various diseases, including cancer. This work aimed to reconstruct CRISPR/Cas13d tool for sensing hTERT exclusively based on the new device OFF-switch hTERT aptazyme that was inserted into the 3’ UTR of the Cas13d. In bladder cancer cells, hTERT ligand bound to aptamer in OFF-switch hTERT aptazyme to inhibit the degradation of Cas13d. Results showed that engineered CRISPR/Cas13d sensing hTERT suppressed cell proliferation, migration, invasion and induced cell apoptosis in bladder cancer 5637 and T24 cells without affecting normal HFF cells. In short, we constructed engineered CRISPR/Cas13d sensing hTERT selectively inhibited the progression of bladder cancer cells significantly. It may serve as a promising specifically effective therapy for bladder cancer cells.

show abstract

“…Aptamers selected from SELEX further need structural and binding characterization and based on such analysis best aptamer candidates are selected for biochemical, functional and biological application. The final selected and characterized aptamers could be used for several applications [13,[37][38][39][40][41][42]. From the discovery of the first SELEX protocol till now, different types of SELEX have been established and merged with other advance technology based on their application in diverge fields [10,15,43,44].…”

Section: Systematic Evolution Of Ligands By Exponential Enrichment (Smentioning

confidence: 99%

Aptamers in HIV research diagnosis and therapy

et al. 2018

Self Cite

View full text Add to dashboard Cite

Aptamers are high affinity single-stranded nucleic acid or protein ligands which exhibit specificity and avidity comparable to, or exceeding that of antibodies and can be generated against most targets. The functionality of aptamers is based on their unique tertiary structure, complexity and their ability to attain unique binding pockets by folding. Aptamers are selected in vitro by a process called Systematic Evolution of Ligands by Exponential enrichment (SELEX). The Kd values for the selected aptamer are often in the picomolar to low nanomolar range. Stable and nontoxic aptamers could be selected for a wide range of ligands including small molecules to large proteins. Aptamers have shown tremendous potential and have found multipurpose application in the field of therapeutic, diagnostic, biosensor and bio-imaging. While their mechanism of action can be similar to that of monoclonal antibodies, aptamers provide additional advantages in terms of production cost, simpler regulatory approval and lower immunogenicity as they are synthesized chemically. Human immunodeficiency virus (HIV) is the primary cause of acquired immune deficiency syndrome (AIDS), which causes significant morbidity and mortality with a significant consequent decrease in the quality of patient's lives. While cART has led to good viral control, people living with HIV now suffer from non-HIV comorbidities due to viral protein expression that cannot be controlled by cART. Hence pathophysiological mechanisms that govern these comorbidities with a focus on therapies that neutralize these HIV effects gained increased attention. Recent advances in HIV/AIDS research have identified several molecular targets and for the development of therapeutic and diagnostic using aptamers against HIV/AIDS. This review presents recent advances in aptamers technology for potential application in HIV diagnostics and therapeutics towards improving the quality of life of people living with HIV.

show abstract

Identification of an RNA aptamer binding hTERT-derived peptide and inhibiting telomerase activity in MCF7 cells

Cited by 16 publications

References 48 publications

Activation of p53 gene expression and synergistic antiproliferative effects of 5-fluorouracil and β-escin on MCF7 cells

Activation of p53 gene expression and synergistic antiproliferative effects of 5-fluorouracil and β-escin on MCF7 cells

Engineered CRISPR/Cas13d Sensing hTERT Selectively Inhibits the Progression of Bladder Cancer In Vitro

Aptamers in HIV research diagnosis and therapy

Contact Info

Product

Resources

About