Identification of ecotropic proviral sequences in inbred mouse strains with a cloned subgenomic DNA fragment.

Abstract

A specific probe for detecting ecotropic murine leukemia virus sequences was constructed by cloning a 500-base-pair DNA segment, corresponding to a portion of the env region of the AKR ecotropic virus, in a pBR322/Escherichia coli K-12 host/vector system. This probe was used to screen the cellular DNAs of six inbred strains of mice for the presence of ecotropic retroviral DNA sequences by the Southern blot hybridization procedure. Three copies of ecotropic viral DNA were detected in AKR/N (a high-ecotropic virus strain) and two were found in BALB/c (a low-ecotropic virus strain) DNAs. As expected, no sequences reactive with this probe were found in NFS mouse DNA (a virus-negative strain). However, cellular DNA sequences that reacted strongly with the ecotropicsecific DNA probe were detected in certain NZB, C57L, and 129 mice (all virus-negative strains). In contrast to the reactive sequences in AKR and BALB/c, the reactions were chiefly associated with EcoRI segments that were subgenomic in size. The chromosomal DNA of inbred and feral mice contains multiple copies of sequences reactive with murine leukemia virus (MuLV) nucleic acid probes (1-7). Among these sequences are complete, potentially infectious genomes of ecotropic and xenotropic viruses (8), the complete genetic information of amphotropic and additional xenotropic viruses that apparently cannot be expressed as infectious viruses in inbred mice (ref. 9; unpublished data), proviral DNA that is expressed only in the form of viral antigens (10-12), and probably many subgenomic viral DNA segments that are not expressed.Because of their abundance in mouse chromosomal DNA and the extensive polynucleotide sequence homology between large portions of the genomes of the various classes of MuLV, little is known about the molecular organization of the endogenous proviral DNA sequences of the particular MuLV types. Although absorption of labeled MuLV cDNA with purified viral RNA from a heterologous MuLV decreases the crossreaction with endogenous sequences (6, 7), such probes still hybridize to a significant extent to related proviruses present in mouse DNA. Clearly, the preparation of nucleic probes that recognize type-specific regions of proviral DNA would offer great advantages.The molecular cloning of AKR ecotropic MuLV (AKV) DNA (13) has made it possible to generate such a probe. We have subcloned, in Escherichia colt K-12 with a pBR322 vector, a portion of the AKV env gene region that is specific for ecotropic viruses in the operational sense that it does not react either with cellular DNA prepared from the prototype ecotropic-negative mouse strain NFS/N or with genomic DNA of a xenotropic MuLV.We describe here the construction and characterization of the recombinant plasmid, illustrate the strategy developed for using the cloned DNA to identify endogenous ecotropic proviruses, and report the presence of a unique set of nucleotide sequences reactive with this probe in the DNA of several mouse strains that, like NFS/N, are biologically negative for...

Strong selection for cells containing new ecotropic recombinant murine leukemia virus provirus after propagation of C57BL/6 radiation-induced thymoma cells in vitro or in vivo.

“…This probe lies in the env gene and had been shown to hybridize exclusively to ecotropic MuLV sequences (1,3). A single KpnI (3.9-kilobase pair [kbp]), EcoRI (25-kbp), or HindIII (7-kbp) fragment was detected in normal C57BL/Ka liver DNA (Fig.…”

“…FIG. 1. Absence of additional ecotropic-specific MuLV sequences in primary radiation-induced thymomas and in infiltrated spleens.…”

Age-dependent tolerance to an endogenous tumor-associated antigen

“…AGATCTCTGTATGTTGGCCCTCCA and gp70-a reverse (nt 462) 5′ TAAGTCTGTTCCAGGCCGTATTGC and gp70-b forward (nt 396) 5′ TCCAGAGATTGTGAGGAG and gp70-b reverse (nt 716) 5′ CCGGATAGTTAAGGAGTTGCA primers were within the region unique to this MuLV (nts 275-819, [31]). cDNA of mouse β-actin was amplified in all samples as a positive control: β-actin forward 5′ AGAGGGAAATCGTGCGTGAC and β-actin reverse 5′ CAATAGTGATGACCTGGCCGT.…”

“…We used two primer sets within the probe identified by Chan et al (gp70 a and gp70 b), which are near the 5′ region of the gp70 transcript and are specific for this MuLV [31]. PCR analyses of cDNA produced from the CT26 tumor cell line resulted in bands of the expected sizes (Fig 1a).…”

SEREX analysis for tumor antigen identification in a mouse model of adenocarcinoma

“…This probe recognizes only the ecotropic env sequence. 39,40 For ATRX, the 2.8-kb insert was isolated and labeled. Each probe was hybridized overnight in hybridization solution as described above, with the probe at a concentration of 20 ng/mL.…”