Identification of human-infective trypanosomes in animal reservoir of sleeping sickness in Uganda by means of serum-resistance-associated (SRA) gene

Welburn, Susan C.; Picozzi, Kim; Fèvre, Eric M.; Coleman, P. G.; Odiit, M.; Carrington, Mark; Maudlin, I.

doi:10.1016/s0140-6736(01)07096-9

Cited by 194 publications

(173 citation statements)

References 18 publications

Supporting

Mentioning

166

Contrasting

Unclassified

Order By: Relevance

“…This PCR test is based on the assumption that human serum resistant trypanosomes have the sra gene and non-human infective trypanosomes do not which appears to hold true for the majority of isolates tested from east and southern Africa Welburn et al 2001;Agbo et al 2003), but not for west and central Africa (Berberof et al 2001;Radwanska et al 2002).…”

Section: Discussionmentioning

confidence: 99%

“…In order to determine the relevance of the sra gene to the human serum resistance phenotypes described here, the PCR tests of Gibson et al (2002) and Welburn et al (2001) were used to determine if the sra gene is present in the stocks which were identified as HSR, HSS and intermediate. The HSS stock, STIB 247, tested positive for the sra gene (confirmed by sequence analysis) whereas the HSR and intermediate stocks, STIB 386 and TREU 927 were both negative.…”

Section: Discussionmentioning

confidence: 99%

“…A similar analysis of a cross STIB 386 x STIB 247 should allow us to map and identify the gene(s) responsible for the HSR phenotype in West African human infective trypanosomes. A, PCR amplification of the sra gene using primers and conditions described in Welburn et al (2001). PCR products from the lines STIB 247, Etat 1.10, Etat 1.2, TREU 927, TREU 927R, STIB 386R and STIB 386S were separated on a 1% Seakem agarose gel and visualized by eithidium bromide staining.…”

Section: Discussionmentioning

confidence: 99%

“…After separation, the RNA was transferred to Hybond nylon membrane using standard protocols, prehybridized in 7% SDS, 0.5M sodium phosphate pH 7.2, 1mM EDTA, at 65°C for 2hrs followed by overnight hybridization with a random primed probe (Sambrook et al 1989). The probe for the sra gene was prepared by PCR amplification of genomic DNA from ETat1.10 using the primers and conditions described by Welburn et al (2001). In order to generate a tubulin probe, a 630bp fragment was amplified from DNA using the primers TUB 3' GGGAATTCTTTCGCATCGAACATCTGCTGC and TUB 5' GGGAATTCCCCCGACAACTTCATCTTTGGA, under the following conditions: 95°C for 50 seconds, 55°C for 50 seconds and 64°C for 1 minutes for 30 cycles.…”

Section: Northern Analysismentioning

confidence: 99%

“…However, while it is clear that the sra gene is responsible for human infectivity in a large number of T. b. rhodesiense isolates Welburn et al 2001), there are exceptions to this in trypanosome lines from East Africa (Rifkin et al 1994;Agbo et al 2003) and, critically, this gene is not present in West African T. b. gambiense isolates (De Greef and Hamers 1994;Radwanska et al 2002). Thus there must be alternative mechanisms determining human infectivity/human serum resistance other than those based on the sra gene.…”

Section: Introductionmentioning

confidence: 99%

See 4 more Smart Citations

Human infectivity trait in Trypanosoma brucei: stability, heritability and relationship to sra expression

et al. 2004

View full text Add to dashboard Cite

Email: m.turner@bio.gla.ac.ukT SUMMARY Some Trypanosoma brucei lines infect humans whereas others do not because the parasites are lysed by human serum. We have developed a robust, quantitative in vitro assay based on differential uptake of fluorescent dyes by live and dead trypanosomes to quantify the extent and kinetics of killing by human serum. This method has been used to discriminate between three classes of human serum resistance; sensitive, resistant and intermediate. TREU 927/4, the parasite used for the T. brucei genome project, is intermediate. The phenotype is expressed in both bloodstream and metacyclic forms, is stably expressed during chronic infections and on cyclical transmission through tsetse flies. Trypanosomes of intermediate phenotype are distinguished from sensitive populations of cells by the slower rate of lysis and by the potential to become fully resistant to killing by human serum as a result of selection or long-term serial passaging in mice and to pass on full resistance phenotype to its progeny in a genetic cross. The sra gene has been shown previously to determine human serum resistance in T. brucei but screening for the presence and expression of this gene indicated that it is not responsible for the human serum resistance phenotype in the trypanosome lines that we have examined, indicating an alternative mechanism for HSR exists in these stocks. Examination of the inheritance of the phenotype in F1 hybrids for both bloodstream and metacyclic stages from two genetic crosses demonstrated that the phenotype is co-inherited in both life cycle stages in a manner consistent with being a Mendelian trait, determined by only one or a few genes.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

Section: Northern Analysismentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Human infectivity trait in Trypanosoma brucei: stability, heritability and relationship to sra expression

et al. 2004

View full text Add to dashboard Cite

show abstract

Trypanosomiases

Gibson¹

2011

Encyclopedia of Life Sciences

View full text Add to dashboard Cite

The human trypanosomiases are vector‐borne tropical diseases that occur in tropical Africa and South America and are caused by parasitic protozoa. Human African trypanosomiasis (or sleeping sickness) is caused by two subspecies of Trypanosoma brucei and is transmitted by the bite of the bloodsucking tsetse fly. Chagas disease occurs in Latin America and is caused by Trypanosoma cruzi . This parasite is transmitted by triatomine bugs, which acquire infection by feeding on infected blood, but pass the parasites on to the next host via their infected faeces. The human trypanosomiases are zoonoses and a range of wild and domestic mammals can act as reservoir hosts for the parasites. There are no vaccines for these diseases and control relies on case treatment and limiting opportunities for transmission. Key Concepts: African human trypanosomiasis or sleeping sickness and Chagas disease in Latin America are caused by insect‐borne, parasitic trypanosomes, but the diseases and the parasite life cycles are completely different. Control of the trypanosomiases relies on treatment of human patients and reduction of transmission, largely achieved through killing the insect vectors. The human trypanosomiases are zoonotic diseases and a range of wild and domestic mammals act as reservoir hosts for the parasites. Vector borne diseases with animal reservoirs have complex epidemiology and are difficult to control. Eradication of human African trypanosomiasis in West Africa seems likely if current treatment, surveillance and tsetse control measures are maintained. Animal reservoir hosts are more important in maintaining human trypanosomiasis in East Africa than West and Central Africa. Eradication of Chagas disease is thwarted by the longevity of infection in humans and circulation of the parasite in a wide range of animal reservoir hosts.

show abstract

Trypanosomiases

Gibson¹

2021

Encyclopedia of Life Sciences

View full text Add to dashboard Cite

The human trypanosomiases are vector‐borne tropical diseases that occur in tropical Africa and South America and are caused by parasitic protozoa. Human African trypanosomiasis (or sleeping sickness) is caused by two subspecies of Trypanosoma brucei and is transmitted by the bite of the bloodsucking tsetse fly. Chagas disease occurs in Latin America and is caused by Trypanosoma cruzi . This parasite is transmitted by triatomine bugs, which acquire infection by feeding on infected blood, but pass the parasites on to the next host via their infected faeces. The human trypanosomiases are zoonoses and a range of wild and domestic mammals can act as reservoir hosts for the parasites. There are no vaccines for these diseases and control relies on drug treatment and limiting opportunities for transmission. Key Concepts Human African trypanosomiasis and Chagas disease are both caused by insect‐borne, parasitic trypanosomes, but the diseases and the parasite life cycles are completely different. Control of the trypanosomiases relies on treatment of human patients and reduction of transmission, largely achieved through killing the insect vectors. The human trypanosomiases are zoonotic diseases and a range of wild and domestic mammals act as reservoir hosts for the parasites. Vector‐borne diseases with animal reservoirs have complex epidemiology and are difficult to control. Elimination of Human African trypanosomiasis as a public health problem in sub‐Saharan Africa seems likely if current treatment, surveillance and tsetse control measures are maintained. Animal reservoir hosts are more important in maintaining Human African trypanosomiasis in East Africa than West and Central Africa. Eradication of Chagas disease is thwarted by the longevity of infection in humans, circulation of the parasite in a wide range of animal reservoir hosts and transmission by routes other than the insect vector.

show abstract

Identification of human-infective trypanosomes in animal reservoir of sleeping sickness in Uganda by means of serum-resistance-associated (SRA) gene

Cited by 194 publications

References 18 publications

Human infectivity trait in Trypanosoma brucei: stability, heritability and relationship to sra expression

Human infectivity trait in Trypanosoma brucei: stability, heritability and relationship to sra expression

Trypanosomiases

Trypanosomiases

Contact Info

Product

Resources

About