Identification of <i>SLF1</i> as a New Copper Homeostasis Gene Involved in Copper Sulfide Mineralization in <i>Saccharomyces cerevisiae</i>

Wang, Yu; Farrell, Rohan A.; Stillman, David J.; Winge, Dennis R.

doi:10.1128/mcb.16.5.2464

Cited by 55 publications

(51 citation statements)

References 45 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…A functional LAM is crucial to mediate the Slf1-specific copper-sensitivity phenotype It was previously reported that overexpression of SLF1 can induce ''hyper-resistance'' of yeast cells to elevated copper salts in the medium (Yu et al 1996). We could confirm that overexpression of SLF1 on a plasmid confers increased resistance of BY4741 wild-type (WT) cells to CuSO 4 ( Fig.…”

Section: Resultssupporting

confidence: 65%

“…Much less is known about Slf1p. It was originally described in a complementation study screening for factors suppressing the cup14 mutation (Yu et al 1996). Cup14 mutants showed increased sensitivity to elevated copper concentrations but grew normally when SLF1 was overexpressed.…”

Section: Introductionmentioning

confidence: 99%

“…Cup14 mutants showed increased sensitivity to elevated copper concentrations but grew normally when SLF1 was overexpressed. Likewise, slf1D cells were sensitive to elevated copper concentrations and lacked the ability to deplete copper from the medium (Yu et al 1996). RBPimmunopurification(RIP)-microarray (RIP-Chip) experiments have been previously performed to define potential RNA targets for the genuine FIGURE 1.…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

La-motif–dependent mRNA association with Slf1 promotes copper detoxification in yeast

Schenk

Meinel²,

Sträßer³

et al. 2012

RNA

View full text Add to dashboard Cite

The La-motif (LAM) is an ancient and ubiquitous RNA-binding domain defining a superfamily of proteins, which comprises the genuine La proteins and La-related proteins (LARPs). In contrast to La, which binds and stabilizes pre-tRNAs and other RNA polymerase III transcripts, data on function and RNA targets of the LARPs have remained scarce. We have undertaken a global approach to elucidate the previously suggested role of the yeast LARP Slf1p in copper homeostasis. By applying RNA-binding protein immunopurification-microarray (RIP-Chip) analysis, we show that Slf1p and its paralog Sro9p copurify with overlapping sets of hundreds of functionally related mRNAs, including many transcripts coding for ribosomal proteins and histones. Interestingly, among these potential RNA targets were also mRNAs coding for proteins critical for protection of cells against elevated copper concentrations. Mutations introduced in the conserved aromatic patch of the LAM in Slf1p drastically impaired both association with its targets and Slf1-mediated protection of cells against toxic copper concentrations. Furthermore, we show that Slf1p stabilizes copper-related mRNA targets in a LAM-dependent manner. These results provide the first evidence for post-transcriptional regulation of factors/pathways implicated in copper homeostasis by a cytoplasmic RBP.

show abstract

Section: Resultssupporting

confidence: 65%

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

La-motif–dependent mRNA association with Slf1 promotes copper detoxification in yeast

Schenk

Meinel²,

Sträßer³

et al. 2012

RNA

View full text Add to dashboard Cite

show abstract

“…To amplify the C. glabrata metallothionein genes MT-I and MT-IIa (28,29) and the C. glabrata transcription factor gene AMT-I, which is involved in the regulation of metallothionein genes (58,59), the following primers were used: for MT-I, MT-I-N5ЈGCTAACGATTGCA AATGTCCT3Ј and MT-I-C5ЈCTTGCACTCACACTTGTCACC3Ј; for MT-IIa, MT-II-N5ЈCCTGAACAAGTCAACTGCCAA3Ј and MT-II-C5ЈGCACTTGCA TGTTTGACACTT3Ј; and for AMT1, AMT-N5ЈATGGTAGTAATCAACGGG GT3Ј and AMT-C5ЈACTAGTGTCATTGCAATTTAA3Ј. To amplify SLF1, a gene involved in copper homeostasis in Saccharomyces cerevisiae (57), the primers used were SLF1-N5ЈATGTCATCGCAAAACCTCAAT3Ј and SLF1-C5ЈCT GCCTGCTAATTTCACCTTG3Ј. To amplify the C. glabrata adhesin gene EPA1 (5), the primers used were EPA1-N5ЈGCGGGGCCCGGTCCCTATGTTCATC ACTA3Ј and EPA1-C5ЈGCGCGCGGATGATTTTAAATCCAGCTCT3Ј.…”

Section: Methodsmentioning

confidence: 99%

“…PCR products were gel purified and used as templates for generating radioactive probes. The PCR product obtained with primers based on the SLFI gene of S. cerevisiae (57) was cloned in Escherichia coli and sequenced in both directions, using an ABI model 373A automatic sequencing system and fluorescent BigDye terminator chemistry (Perkin-Elmer/Applied Biosystems Inc., Foster City, Calif.). The alignment of nucleotide sequences and comparison with sequences in the databases were performed with the BLASTX-BEAUTY analysis program (10,56).…”

Section: Methodsmentioning

confidence: 99%

Phenotypic Switching in Candida glabrata Involves Phase-Specific Regulation of the Metallothionein Gene MT-II and the Newly Discovered Hemolysin Gene HLP

et al. 2000

View full text Add to dashboard Cite

Although Candida glabrata has emerged in recent years as a major fungal pathogen, there have been no reports demonstrating that it undergoes either the bud-hypha transition or high-frequency phenotypic switching, two developmental programs believed to contribute to the pathogenic success of other Candida species. Here it is demonstrated that C. glabrata undergoes reversible, high-frequency phenotypic switching between a white (Wh), light brown (LB), and dark brown (DB) colony phenotype discriminated on an indicator agar containing 1 mM Candida glabrata has emerged as one of the three most common Candida species colonizing humans (8, 12). C. glabrata now represents the second-most-common Candida species causing bloodstream infections (36) and, at least in the Detroit area, one of the prevalent species responsible for yeast vaginitis (42,52). A dramatic increase in the carriage of C. glabrata has also been demonstrated in dentate individuals over 80 years of age, and the proportion of elderly individuals with dentures carrying C. glabrata in one study was found to be greater than 50% (23). What is most worrisome about the recent emergence of C. glabrata as a major Candida pathogen and commensal is that it is naturally resistant to azole drug therapy (3,9,14,27).The success of the most prevalent Candida pathogen, C. albicans, depends in part on its phenotypic plasticity. C. albicans exhibits two developmental programs that provide a portion of its phenotypic plasticity, the bud-hypha transition (11, 44) and high-frequency phenotypic switching (45-47). Transition to a hyphal growth form provides C. albicans with the capacity to penetrate tissue and disseminate (35), and mutants of C. albicans that do not form hyphae exhibit a reduction in virulence in animal models (20,37,43). High-frequency phenotypic switching involves the combinatorial regulation of phase-specific genes (45-47), several of which appear to facilitate pathogenesis, including secreted aspartyl proteinases (15,32,33,55) and drug resistance genes (1). Misexpression of phase-specific genes in the wrong phase alters the specificity of virulence in different animal models (18,19). Surprisingly, C. glabrata has never been reported to undergo either the budhypha transition or high-frequency phenotypic switching. How, then, has C. glabrata achieved its recent success both as a commensal and as a pathogen? One possible answer is that the developmental plasticity afforded by the bud-hypha transition and high-frequency phenotypic switching is really not important in the overall pathogenesis of an infectious yeast. An alternative answer is that although these two developmental programs are important to C. albicans (45) and other highly related species (50; S. O. Soll, S. R. Lockhart, and D. R. Soll, unpublished observations), they may not be important for the pathogenesis of C. glabrata. C. glabrata may have developed alternative mechanisms that generate the plasticity that these developmental programs provide for rapid responses to environmental challenges. He...

show abstract

A network of proteins around Rvs167p and Rvs161p, two proteins related to the yeast actin cytoskeleton

Bon

Recordon-Navarro²,

Durrens

et al. 2000

Yeast

View full text Add to dashboard Cite

The Rvs161p and Rvs167p proteins of Saccharomyces cerevisiae, homologues of higher eukaryotes' amphiphysins, associate with actin and appear to be involved in several functions related to the actin cytoskeleton. In order to identify partners of the Rvsp proteins, yeast libraries constructed in two‐hybrid vectors were screened using either Rvs167p or Rvs161p as a bait. The selected candidates, representing 34 ORFs, were then tested against both Rvsp proteins, as well as domains of Rvs167p or Rvs161p. Among the most significant ones, 24 ORFs were specific preys of Rvs167p only and two gave interactions with Rvs161p only. Interestingly, five ORFs were preys of both Rvs161p and Rvs167p (RVS167, LAS17, YNL094w, YMR192w and YPL249c). Analysis of putative functions of the candidates confirm involvement of the Rvsp in endocytosis/vesicle traffic, but also opens possible new fields, such as nuclear functions. Copyright © 2000 John Wiley & Sons, Ltd.

show abstract

Identification of SLF1 as a New Copper Homeostasis Gene Involved in Copper Sulfide Mineralization in Saccharomyces cerevisiae

Cited by 55 publications

References 45 publications

La-motif–dependent mRNA association with Slf1 promotes copper detoxification in yeast

La-motif–dependent mRNA association with Slf1 promotes copper detoxification in yeast

Phenotypic Switching in Candida glabrata Involves Phase-Specific Regulation of the Metallothionein Gene MT-II and the Newly Discovered Hemolysin Gene HLP

A network of proteins around Rvs167p and Rvs161p, two proteins related to the yeast actin cytoskeleton

Contact Info

Product

Resources

About