Identification of lactoferrin as the granulocyte-derived inhibitor of colony-stimulating activity production.

Broxmeyer, Hal E.; Smithyman, Anthony M.; Eger, Richard; Meyers, P. A.; Sousa, Maria de

doi:10.1084/jem.148.4.1052

Cited by 280 publications

(73 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We cannot exclude the possibility that a subpopulation of lymphoid, granulocytic or tumour cells which also adhere might play an accessory role in this growth-stimulatory process. It is possible that tumour cells produce colony-stimulating activity (CSA) (Okabe et al, 1978) which has been shown to be capable of influencing prostaglandin E production (Kurland et al, 1979) and, furthermore, contaminating polymorphonuclear leucocytes can affect CSA by release of lactoferrin (Broxmeyer et al, 1978). However, it has previously been reported that phagocytic depletion alone (which would not remove lymphoid cells) markedly reduces tumour-colony growth (Hamburger et al, 1978) reinforcing the central regulatory role of the macrophage.…”

Section: Methodsmentioning

confidence: 99%

Effect of host-cell interactions on clonogenic carcinoma cells in human malignant effusions

Buick¹,

Fry²,

Salmon³

1980

Br J Cancer

View full text Add to dashboard Cite

Summary.-We have studied the clonogenic capacity of tumour cells in agar from 38 malignant effusions from 31 patients with epithelial tumours. Colony formation of unfractionated cells varies considerably from patient to patient, and is positively correlated with the percentage of tumour cells in the sample. Clonogenicity was shown to be reduced in 8/9 cases by removal of plastic-adherent and iron-phagocytic cells. In the ninth case, increased clonogenicity occurred after this procedure. When the autologous adherent cells were removed from the effusion and used in reconstitution experiments as an underlayer in a two-layer agar system, they were able to reverse the effect of the initial fractionation in a dose-dependent fashion. This indicates cellular communication based on release of a diffusible product of plasticadherent cells. Morphological, phagocytic and prostaglandin-synthetic analysis of the fractions involved in the reconstitution experiments implicate the macrophage as the operative cell in this interaction. However, an accessory role for lymphoid cells or tumour cells themselves cannot be excluded.

show abstract

Section: Methodsmentioning

confidence: 99%

Effect of host-cell interactions on clonogenic carcinoma cells in human malignant effusions

Buick¹,

Fry²,

Salmon³

1980

Br J Cancer

View full text Add to dashboard Cite

show abstract

“…Alternatively, C/EBP⑀ induces the expression of target genes such as lactoferrin in mature granulocytes which may be involved in the negative (feedback) regulation of myelopoiesis. 12,13 The bone marrow morphology of C/EBP⑀ −/− mice suggested the coexistence of increased proliferation and apoptosis, with nearly 100% cellularity on biopsy specimen of the marrow and prominent pseudo-Gaucher cells throughhout the marrow. We, therefore, investigated whether myeloid cells in C/EBP⑀ −/− mice show abnormalities in their proliferative behavior in vivo and in vitro as well as in their response to apoptotic stimuli.…”

Section: Introductionmentioning

confidence: 99%

C/EBPε −/− mice: increased rate of myeloid proliferation and apoptosis

et al. 2001

View full text Add to dashboard Cite

CCAAT/enhancer binding protein epsilon (C/EBP⑀) is essential for terminal granulocytic differentiation. Its expression begins at the transition between the proliferative and non-proliferative compartments of myelopoiesis. We studied the effect of targeted disruption of the C/EBP⑀ gene on murine myeloid proliferation and apoptosis. Bone marrow cellularity of C/EBP⑀ −/− and wild-type mice was 95% and 65%, respectively. The C/EBP⑀ −/− mice had an expansion in the number of their CFU-GM/femur. The number of myeloid committed progenitor cells in the peripheral blood and the spleen of these mice was also increased. Bromodeoxyuridine (BrDU) pulse labeling studies demonstrated that the fraction of actively proliferating cells was two-fold higher in the bone marrow of C/EBP⑀ −/− mice. However, the number of myeloid colonies arising from purified Sca-1+/lin− early hematopoietic progenitor cells and from bone marrow mononuclear cells grown in different cytokine combinations was not significantly different between wild-type and knock-out mice. Also, long-term marrow growth, and CFU were not different between the wild-type and C/EBP⑀ −/− mice. The sensitivity to induction of apoptosis in the committed progenitor cell compartment after either withdrawal of growth factor or brief exposure to etoposide was normal. However, Gr-1 antigen-positive C/EBP⑀ −/− granulocytic cells showed an increased rate of apoptosis in comparison to their wild-type counterparts. In summary, the myeloid compartment appears to be expanded in mice lacking C/EBP⑀. However, this is not the consequence of an intrinsic myeloproliferation but due to an indirect, possibly cytokine-mediated stimulation of myelopoiesis in vivo. C/EBP⑀ may have a role in the inhibition of apoptosis in maturing granulocytic cells. Leukemia (2001) 15, 103-111.

show abstract

“…14 19 However, LTF exerts various immunomodulatory effects in monocytes, macrophages and neutrophils 17 and may affect myelopoiesis. 20,21 A membrane-bound form of LTF (CSP82) has been implicated in regulating dendritic development in vitro and in vivo. 22 In a search for myeloid-specific markers that are absent from HSCs, lymphoid and erythroid cells, we analyzed the expression pattern of Ltf during hematopoietic development.…”

Section: Introductionmentioning

confidence: 99%

Lactotransferrin-Cre reporter mice trace neutrophils, monocytes/macrophages and distinct subtypes of dendritic cells

et al. 2014

View full text Add to dashboard Cite

© F e r r a t a S t o r t i F o u n d a t i o nhematopoiesis has revealed that HSCs express C/EBPα. 16To the best of our knowledge, there is no available mouse model for tracing myeloid cells without concurrent labeling of HSCs and lymphoid cells. Lactotransferrin (LTF, LF, CSP82) is well known as an iron-binding protein in the milk, saliva and mucosal secretions of the trachea, uterus and ovaries and has been implicated in innate immune responses against microbial infections.17,18 Ltf knockout mice have normal iron homeostasis and show no gross abnormalities with respect to terminal differentiation into hematopoietic lineages. 19 However, LTF exerts various immunomodulatory effects in monocytes, macrophages and neutrophils 17 and may affect myelopoiesis. 20,21 A membrane-bound form of LTF (CSP82) has been implicated in regulating dendritic development in vitro and in vivo. 22 In a search for myeloid-specific markers that are absent from HSCs, lymphoid and erythroid cells, we analyzed the expression pattern of Ltf during hematopoietic development.Here, we show that Ltf is specifically expressed in Gr-1 + /CD11b + bone marrow (BM) cells. To delineate the cellular compartments derived from Ltf + progenitors during hematopoietic development in vivo, we employed a lineage-tracing mouse model expressing Cre recombinase under the control of the Ltf-promoter, together with the irreversibly Cre-inducible tandem-dimer red fluorescent protein (tdRFP). 23 We show the Ltf-reporter + cells give rise to populations of dendritic cells (DCs), monocytes, macrophages and neutrophils, while sparing eosinophils, T cells, B cells, natural killer (NK) cells and erythrocytes. Methods MiceAll mice were kept under specific pathogen-free conditions at the University of Veterinary Medicine Vienna and the Research Institute of Molecular Pathology. Animal experiments were discussed and approved by the institutional ethics committees and were performed in accordance with Austrian law (BMWF-68.205/0243-II/3b/2011 and 66.009/0065-II/10b/2009). Generation of B6;129Sv-Tg(Ltf-iCre)14 transgenic miceA codon-improved Cre (iCre) recombinase was inserted into a bacterial artificial chromosome carrying the Ltf gene (BAC; RP24-166N8; purchased from Children's Hospital Oakland Research Institute, Oakland, CA, USA) via homologous recombination in E. coli. A cassette containing the iCre recombinase, an artificial intron, a bovine growth hormone polyadenylation signal and an ampicillin-resistance gene flanked by Frt (Flp recombinase target) sites, was recombined into the first exon of the Ltf gene. To delete the ampicillin gene, a plasmid expressing FLP recombinase was transfected into E. coli harboring the recombined BAC. Correct insertion and amp R -gene deletion were verified by Southern blotting and by DNA sequencing. BAC was purified using a CsCl-gradient and ultracentrifugation and injected into the pro-nuclei of B6/129SvF1 oocytes. Genotyping of B6;129Sv-Tg(Ltf-iCre)14 (Ltf-Cre + ) mice was performed with primers GGAAGCTGGCCTCTAAGAAC (forwa...

show abstract

Identification of lactoferrin as the granulocyte-derived inhibitor of colony-stimulating activity production.

Cited by 280 publications

References 31 publications

Effect of host-cell interactions on clonogenic carcinoma cells in human malignant effusions

Effect of host-cell interactions on clonogenic carcinoma cells in human malignant effusions

C/EBPε −/− mice: increased rate of myeloid proliferation and apoptosis

Lactotransferrin-Cre reporter mice trace neutrophils, monocytes/macrophages and distinct subtypes of dendritic cells

Contact Info

Product

Resources

About