Identification of new dinucleotide‐repeat polymorphisms in factor VIII gene using fluorescent PCR

Abstract

Haemophilia A is an X-linked inherited bleeding disorder. Linkage diagnosis using polymorphic markers in the factor VIII gene is used to archive the carrier detection and prenatal diagnosis. The objective of this study was to establish the allele frequency and heterozygosity rate (HR) of two new intragenic markers (Intron 1 and 24) and other markers (Intron 13 and 22) using fluorescent PCR. Five hundred unrelated healthy women were screened and haemophilic family was studied for carrier detection and prenatal diagnosis. We observed five different alleles of Intron 1, 10 of Intron 24, nine of Intron 13 and six of Intron 22. The observed HR for Intron 1, 24, 13 and 22 were 34.0, 35.2, 53.0 and 42.6%, while the expected HR were 33.6, 36.3, 50.1 and 44.3%, respectively. Heterozygosity rate with the combined use of all four intragenic markers was 76.6% (383/500). In prenatal diagnosis of a haemophilic family, a pregnant woman was heterozygous with three intragenic (Intron 1, 13 and 22) and one extragenic St14 VNTR (DXS52) markers. She was considered to be a carrier, and she carried a male foetus by AMXY PCR and chromosome analysis of amniocytes. Foetus did not have mutant haplotype as his uncle, suggesting a normal male status. Our study demonstrates the utility of two new intragenic markers in FVIII gene for carrier detection and prenatal diagnosis of haemophilic families.

A highly informative, multiplexed assay for the indirect detection of hemophilia A using five‐linked microsatellites

“…The panel's informativity in the local Caucasian population is near 100% when all markers are used, and thus it should be directly applicable in the majority of F8Int13F GTTTCTT TGCATTCAACTGTACATAATGTATCTT 158 F8Int13R FAM-CCAAATTACAGATTGAATAAGCCTAG F8Int22F GTTTCTT ATTAATGCCCACATTATAGACTCTC 211 F8Int22R FAM-AATAAGACCCTTAGCTGTTTCAT DXS1108F GTTTCTT GAATTCATCATATGTGATTTCCACAG 105 DXS1108R FAM-CCATCTTGGGGGATACAGTG families requiring linkage analysis. This compares well with the 76.6% overall heterozygosity achieved by Kim et al [15] in their assay utilizing four intragenic microsatellite markers. The difference in informativity might be due in part to the fact that five markers were used in this assay.…”

“…Each allele is named according to number of repeat units; DXS9897 is a tetranucleotide and as such has a number of half-repeat units, signified by 0. clinical practice. With these caveats, the method described here represents an improvement on other published linkage assays, and an alternative to the recent method described by Kim et al [15]. It should prove useful in familial hemophilia A when other molecular techniques have failed to identify the causative mutation.…”

“…It was therefore decided to develop an assay that required a single multiplexed PCR reaction for each sample and in which analysis was carried out by the same method, thereby increasing the speed and decreasing the labor and reagent cost per sample. A similar method has recently been published, using four intragenic dinucleotide repeat markers, but it has a relatively low informativity of 76.6% for the combined panel of four markers in the population tested [15]. In order to determine the informativity of the assay developed here, 50 unrelated females from the local population were analyzed.…”

Genotype-Phenotype Interaction Analyses in Hemophilia

“…According to the gene sizes of factor VIII (186 kb) and factor IX (34 kb), both genes would be expected to be ~144 and 27 SNPs, respectively. However, fewer polymorphisms have been identified, which means a paucity of polymorphisms or a detection problem, this last reason being more plausible because new polymorphisms continue to be described (Figure 2) (Bowen, 2002;Kim, 2005).…”

“…According to their diagnostic informativeness percentage in the Mexican population, for factor VIII gene we initially used the following: the microsatellite of (CA)n of intron 13 (75%) and the RFLPs BclI-intron 18 (50%) and AlwNIintron 7 (20%) (Mantilla-Capacho et al, 2005). In order to improve the technical feasibility and informative level of carrier diagnosis in Mexican families with hemophilia A, we used the method of Kim et al (2005) based on fluorescent PCR of four intragenic dinucleotide-repeat polymorphisms analyzed by automated Genescan®. Preliminary data show that the use of dinucleotide repeats at introns 1, 13 and 22 achieved a significant increase in informativeness (>85%), which is useful for carrier testing in more than 200 hemophilia A families (González-Ramos et al, 2010).…”