Identification of Potential Genetic Biomarkers and Target Genes of Peri-Implantitis Using Bioinformatics Tools

Abstract

Objectives. To investigate potential genetic biomarkers of peri-implantitis and target genes for the therapy of peri-implantitis by bioinformatics analysis of publicly available data. Methods. The GSE33774 microarray dataset was downloaded from the Gene Expression Omnibus (GEO). The differentially expressed genes (DEGs) between peri-implantitis and healthy gingival tissues were identified using the GEO2R tool. GO enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis were performed using the DAVID database and the Metascape tool, and the results were expressed as a bubble diagram. The protein-protein interaction network of DEGs was constructed using the Search Tool for the Retrieval of Interacting Genes (STRING) and visualized using Cytoscape. The hub genes were screened by the cytoHubba plugin of Cytoscape. The potential target genes associated with peri-implantitis were obtained from the DisGeNET database and the Open Targets Platform. The intersecting genes were identified using the Venn diagram web tool. Results. Between the peri-implantitis group and the healthy group, 205 DEGs were investigated including 140 upregulated genes and 65 downregulated genes. These DEGs were mainly enriched in functions such as the immune response, inflammatory response, cell adhesion, receptor activity, and protease binding. The results of KEGG pathway enrichment analysis revealed that DEGs were mainly involved in the cytokine-cytokine receptor interaction, pathways in cancer, and the PI3K-Akt signaling pathway. The intersecting genes, including IL6, TLR4, FN1, IL1β, CXCL8, MMP9, and SPP1, were revealed as potential genetic biomarkers and target genes of peri-implantitis. Conclusions. This study provides supportive evidence that IL6, TLR4, FN1, IL1β, CXCL8, MMP9, and SPP1 might be used as potential target biomarkers for peri-implantitis which may provide further therapeutic potentials for peri-implantitis.

Identification and external validation of the hub genes associated with cardiorenal syndrome through time-series and network analyses

“…Genes exhibiting significant expression differences at all four time points were selected and included in the PPI network analysis [ 18 ]. The PPI network was based on the STRING database (version 11.5, https://cn.string-db.org/ ), and the confidence level was set to 0.4 [ 19 ]. The CytoHubba plug-in (version 0.1) in the Cytoscape software (version 3.8.0) was used to measure the importance of the genes in the network, and genes with a degree ≥10 were considered as hub genes [ 20 ].…”

“…Forward: CGGTGGCTGTCAGTCAAAG Reverse: AAACCTCGGCTTCCTCCATAA POSTN Forward: CTCATAGTCGTATCAGGGGTCG Reverse: ACACAGTCGTTTTCTGTCCAC GAPDH Forward: GGAGCGAGATCCCTCCAAAAT Reverse: GGCTGTTGTCATACTTCTCATGG exhibiting significant expression differences at all four time points were selected and included in the PPI network analysis [18]. The PPI network was based on the STRING database (version 11.5, https://cn.stringdb.org/), and the confidence level was set to 0.4 [19].…”

Chemical constituents, biological activities and anti‐rheumatoid arthritic properties of four citrus essential oils

“…The results of the KEGG enrichment pathway were used to explain the potential molecular mechanisms of the four essential oils on RA. Bubble maps of the pathways were plotted by RStudio (Zhang, Wang, Hu, Shen, & Liu, 2021).…”

Identifying biotic stress-associated molecular markers in wheat using differential gene expression and machine learning techniques

“…With the help of the R/Bioconductor and Limma package, the online statistical tool GEO2R [16] was used to analyze the raw six gene expression data sets of wheat under different biotic stresses from GEO datasets [17] (table1). The samples have been clustered into two groups (control and infected / treatment).…”