Identification of putative pathogens in acute endodontic infections by PCR based on 16S rDNA

Abstract

The purpose of this study was to investigate the frequency of 7 putative pathogens in endodontic infections. The specimens were collected from infected pulpal tissue of patients who were referred for root canal treatment to the department of conservative dentistry, Chosun University. Samples were collected aseptically using a barbed broach and a paper point. The cut barbed broaches and paper points were transferred to an eppendorf tube containing 500 ml of 1 X PBS. DNAs were extracted from the samples by direct DNA extraction method using lysis buffer (0.5% EDTA, 1% Triton X-100). Identification of 7 putative pathogens was performed by PCR based on 16S rDNA. The target species were as follows: Porphyromonas endodontalis, Porphyromonas gingivalis, Prevotella intermedia, Prevotella nigrescens, Bacteroides forsythus, Actinobacillus actinomycetemcomitans, and Treponema denticola. Our data revealed that the prevalence of P. endodontalis was found in 88.6% (39/54), P. gingivalis 52.3% (23/44), P. nigrescens 18.2% (8/44), P. intermedia 15.9% (7/44), B. forsythus 18.2% (8/44), A. actinomycetemcomitans 2.3% (1/44), T. denticola 25% (11/44) of the samples. The high prevalence of P. endodontalis and P. gingivalis suggests that they may play an important role in the etiology of endodontic infections. . 하지만, oral spirochetes도 1950년대부터 감염 근관에서 발견되었다는 보고가 있었다 [26][27][28][29] . 최근에 Siqueira 등 . 본 연구에서는 샘플의 25%에서 T. denticola가 발견되 었고, 이것은 T. denticola가 치수 및 치근단 질환을 일으킬 수 있는 가능성이 있다는 것을 보여주는 것으로 생각된다. 그러나 T. denticola가 확실한 치수 및 치근단 질환의 주 원 인균인지는 더 많은 연구를 통해 고찰되어야 할 것으로 사 료된다.B

Genomic study of oral lichen planus and oral microbiome with RNAseq

“…PCR assays were used to confirm microbes identified from RNAseq. Primer for detection of Prevotella denticola was: Forward Primers: TAATACCGAATGTGCTCATTTACAT Reversed primer: TCAAAGAAGCATTCCCTCTTCTTCTTA with an amplicon size of 316 bp (10).…”