Identification of Reptarenaviruses, Hartmaniviruses, and a Novel Chuvirus in Captive Native Brazilian Boa Constrictors with Boid Inclusion Body Disease

Abstract

Boid inclusion body disease (BIBD) is a transmissible viral disease of captive snakes that causes severe losses in snake collections worldwide. It is caused by reptarenavirus infection, which can persist over several years without overt signs but is generally associated with the eventual death of the affected snakes. Thus far, reports have confirmed the existence of reptarenaviruses in captive snakes in North America, Europe, Asia, and Australia, but there is no evidence that it also occurs in wild snakes. BIBD affects boa species within the subfamily Boinae and pythons in the family Pythonidae, the habitats of which do not naturally overlap. Here, we studied Brazilian captive snakes with BIBD using a metatranscriptomic approach, and we report the identification of novel reptarenaviruses, hartmaniviruses, and a new species in the family Chuviridae. The reptarenavirus L segments identified are divergent enough to represent six novel species, while we found only a single novel reptarenavirus S segment. Until now, hartmaniviruses had been identified only in European captive boas with BIBD, and the present results increase the number of known hartmaniviruses from four to six. The newly identified chuvirus showed 38.4%, 40.9%, and 48.1% amino acid identity to the nucleoprotein, glycoprotein, and RNA-dependent RNA polymerase, respectively, of its closest relative, Guangdong red-banded snake chuvirus-like virus. Although we cannot rule out the possibility that the found viruses originated from imported snakes, the results suggest that the viruses could circulate in indigenous snake populations. IMPORTANCE Boid inclusion body disease (BIBD), caused by reptarenavirus infection, affects captive snake populations worldwide, but the reservoir hosts of reptarenaviruses remain unknown. Here, we report the identification of novel reptarenaviruses, hartmaniviruses, and a chuvirus in captive Brazilian boas with BIBD. Three of the four snakes studied showed coinfection with all three viruses, and one of the snakes harbored three novel reptarenavirus L segments and one novel S segment. The samples originated from collections with Brazilian indigenous snakes only, which could indicate that these viruses circulate in wild snakes. The findings could further indicate that boid snakes are the natural reservoir of reptarena- and hartmaniviruses commonly found in captive snakes. The snakes infected with the novel chuvirus all suffered from BIBD; it is therefore not possible to comment on its potential pathogenicity and contribution to the observed changes in the present case material.

Metagenomic sequencing reveals a lack of virus exchange between native and invasive freshwater fish across the Murray–Darling Basin, Australia

“…This Hardyhead chuvirus displayed three open reading frames, representing the L protein (RdRp), glycoprotein and nucleoprotein. Our analysis identified Guangdong red-banded snake chuvirus ( Shi et al 2018 ) as the closest relative of the L protein (44% amino acid similarity), Wenling fish chu-like virus ( Shi et al 2018 ) as the closest relative of the glycoprotein (41%) and Herr Frank virus 1 ( Argenta et al 2020 ) as the closest relative of the nucleoprotein (34%). Hardyhead chuvirus formed a distinct phylogenetic clade with all other vertebrate-associated chuviruses ( Fig.…”

“…The phylogenetic range of the Chuviridae largely incorporates invertebrate hosts with diverse genomes (segmented, unsegmented and circular) ( Jun-Hua et al 2015 ). Recently, chuviruses have been discovered in vertebrates, all possessing three segments ( Shi et al 2018 ; Argenta et al 2020 ). The novel chuvirus detected here in the unspecked hardyhead displayed these genomic features with the L gene (RdRp), S gene (glycoprotein) and N gene (nucleoprotein) all related to fish and reptile viruses ( Fig.…”

Short ‘1.2× Genome’ Infectious Clone Initiates Kolmiovirid Replication in Boa constrictor Cells

“…To normalize the SwSCV-1 RNA levels against a house-keeping gene, we ordered the following primers and probe for the detection of Boa constrictor glyceraldehyde-3-phosphate dehydrogenase (GAPDH): forward primer: 5' CTGGTATGACAACGAATA 3', reverse primer: 5' CAGTCTTTACTCCTTAGATG 3', and probe 5' 6-Fam (carboxyfluorescein)-TGAACCAACAAGTCTACCACACG-BHQ-1 3'. Reference assembly using Python bivitattus GAPDH (GenBank accession: XM_007429612.3) as the template in Unipro UGENE (http: //ugene.net/; accessed on 11 July 2019) [39] served to obtain the mRNA for B. constrictor GAPDH from the reads of our earlier metatranscriptomic studies [35,[40][41][42].…”

Virome Analysis of Signal Crayfish (Pacifastacus leniusculus) along Its Invasion Range Reveals Diverse and Divergent RNA Viruses

“…Virus-like contig 145 (signal crayfish-associated chu-like virus 4, 1009 bp) had a 30% amino acid sequence identity to RdRp. The Beihai hermit crab virus 3 belongs to the Mivirus genus from the recently discovered negative-strand RNA Chuviridae family, characterized by HTS analysis only [3,31,58]. Diverse chuvirus-derived endogenous viral elements were also detected in mosquito genomes [59].…”