Identification of Rickettsiae Isolated in Japan as Coxiella burnetii by 16S rRNA Sequencing

Masuzawa, Toshiyuki; Sawaki, Katsuji; Nagaoka, Hiromi; Akiyama, Masato; Hirai, Katsuya; Yanagihara, Yasutake

doi:10.1099/00207713-47-3-883

Cited by 21 publications

(12 citation statements)

References 9 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Samples with positive PCR products (confirmed through Sanger sequencing) were subjected to another Coxiella genus-specific PCR targeting 1.45 kb of the 16S rRNA gene (long 16S) using the primer pairs Cox-16s-1457F (QR-F0 5"ATTGAAGAGTTTGATTCTGG) and Cox-16s-1457R (QR-R0 5" CGGCTTCCCGAAGGTTAG) (Masuzawa et al, 1997). All PCRs contained 2 μL of DNA extracted from ticks, 1 x PCR buffer, 2.5 mM MgCl 2 , 1 mM dNTPs, 0.01 mg BSA (Fisher Biotech, Australia), 1.25 U Perfect Taq Polymerase (5 Prime, Germany), and 400 nM of each primer in a total volume of 25 μL.…”

Section: Conventional Pcrmentioning

confidence: 99%

Molecular investigation into the presence of a Coxiella sp. in Rhipicephalus sanguineus ticks in Australia

Oskam

Gofton

Greay

et al. 2017

Veterinary Microbiology

View full text Add to dashboard Cite

Molecular investigation into the presence of a Coxiella sp.in Rhipicephalus sanguineus ticks in Australia.Veterinary Microbiology http://dx.doi.org/10. 1016/j.vetmic.2017.01.021 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. turanicus ticks overseas. This study illustrates the value of using genus specific PCR assays to detect previously unreported bacterial species. Furthermore, the presence of an additional Coxiella sp. in Australia requires further investigation into its potential for contributing to serological crossreactions during Q fever testing.

show abstract

Section: Conventional Pcrmentioning

confidence: 99%

Molecular investigation into the presence of a Coxiella sp. in Rhipicephalus sanguineus ticks in Australia

Oskam

Gofton

Greay

et al. 2017

Veterinary Microbiology

View full text Add to dashboard Cite

show abstract

“…Occasionally, a 33 to 42 kb plasmid (depending on the plasmid considered) can be observed but its function remains to be determined [33]. Bacterial isolates can be identified by a probe to 16S ribosomal RNA (rRNA), which is highly conserved [34]. Genetic heterogeneity of Coxiella burnetii is limited with approximately 30 distinct variants [35].…”

Section: Causal Agentmentioning

confidence: 99%

Q Fever: Current State of Knowledge and Perspectives of Research of a Neglected Zoonosis

Porter

Czaplicki²,

Mainil

et al. 2011

International Journal of Microbiology

195

201

View full text Add to dashboard Cite

Q fever is an ubiquitous zoonosis caused by an resistant intracellular bacterium, Coxiella burnetii. In certain areas, Q fever can be a severe public health problem, and awareness of the disease must be promoted worldwide. Nevertheless, knowledge of Coxiella burnetii remains limited to this day. Its resistant (intracellular and environmental) and infectious properties have been poorly investigated. Further understanding of the interactions between the infected host and the bacteria is necessary. Domestic ruminants are considered as the main reservoir of bacteria. Infected animals shed highly infectious organisms in milk, feces, urine, vaginal mucus, and, very importantly, birth products. Inhalation is the main route of infection. Frequently asymptomatic in humans and animals, Q fever can cause acute or chronic infections. Financial consequences of infection can be dramatic at herd level. Vaccination with inactive whole-cell bacteria has been performed and proved effective in humans and animals. However, inactive whole-cell vaccines present several defects. Recombinant vaccines have been developed in experimental conditions and have great potential for the future. Q fever is a challenging disease for scientists as significant further investigations are necessary. Great research opportunities are available to reach a better understanding and thus a better prevention and control of the infection.

show abstract

“…Masuzawa et al [42] showed that the levels of sequence similarity of 16S rRNA genes among Japanese isolates (including 1M, 27M, 50F, 58T and 605) and American isolates (Bangui, Ohio and G Q212) were higher than 99%.…”

Section: Banding and Immunoblotting Patterns Of Proteins And Lipopolymentioning

confidence: 99%

Advances in the Understanding of Coxiella burnetii Infection in Japan.

Hirai

1998

J. Vet. Med. Sci.

View full text Add to dashboard Cite

Identification of Rickettsiae Isolated in Japan as Coxiella burnetii by 16S rRNA Sequencing

Cited by 21 publications

References 9 publications

Molecular investigation into the presence of a Coxiella sp. in Rhipicephalus sanguineus ticks in Australia

Molecular investigation into the presence of a Coxiella sp. in Rhipicephalus sanguineus ticks in Australia

Q Fever: Current State of Knowledge and Perspectives of Research of a Neglected Zoonosis

Advances in the Understanding of Coxiella burnetii Infection in Japan.

Contact Info

Product

Resources

About