Identification of Transcripts Involved in Resistance Responses to Leaf Spot Disease Caused by Cercosporidium personatum in Peanut (Arachis hypogaea)

Abstract

Late leaf spot disease caused by Cercosporidium personatum is one of the most destructive foliar diseases of peanut (Arachis hypogaea) worldwide. The objective of this research was to identify resistance genes in response to leaf spot disease using microarray and real-time polymerase chain reaction (PCR). To identify transcripts involved in disease resistance, we studied the gene expression profiles in two peanut genotypes, resistant or susceptible to leaf spot disease, using cDNA microarray containing 384 unigenes selected from two expressed sequenced tag (EST) cDNA libraries challenged by abiotic and biotic stresses. A total of 112 spots representing 56 genes in several functional categories were detected as up-regulated genes (log(2) ratio > 1). Seventeen of the top 20 genes, each matching gene with known function in GenBank, were selected for validation of their expression levels using real-time PCR. The two peanut genotypes were also used to study the functional analysis of these genes and the possible link of these genes to the disease resistance trait. Microarray technology and real-time PCR were used for comparison of gene expression. The selected genes identified by microarray analysis were validated by real-time PCR. These genes were more greatly expressed in the resistant genotype as a result of response to the challenge of C. personatum than in the susceptible genotype. Further investigations are needed to characterize each of these genes in disease resistance. Gene probes could then be developed for application in breeding programs for marker-assisted selection.

Research Article Coupled transcript and metabolite identification: insights on induction and synthesis of resveratrol in peanut, wild relatives and synthetic allotetraploid.

“…qRT-PCR assays were performed in a F7300 Real Time PCR (Applied Biosystems, Foster City, CA, USA) using 5 mL Platinum SYBR Green qPCR Super Mix-UDG w/ROX kit (Invitrogen) in a 10-mL final volume reaction containing 2 mL diluted cDNA and 0.2 mM of each primer. The following two reference genes were used: Arachis Ubiquitin (Fwd-5'AAGCCGAAGAAGATCAAGCAC3', Rev-5'GGTTAGCCATGAAGGTTCCAG3') (Luo et al, 2005) and Ribosomal 60S (Fwd-5'GAGCTGAAAGATTCCGATGC3', Rev-5'GCAATGCCTGGGAACATAGTC3') (Jain et al, 2006). Those two pairs for primers were designed in intron flanking regions which also allows the distinction between PCR products amplified from genomic DNA and cDNA templates.…”

Advancements in molecular marker development and their applications in the management of biotic stresses in peanuts

“…Near isogenic lines (NILs) developed for rust resistance were thoroughly screened with both foreground and background molecular markers (Yeri et al, 2014). For the identification of LLS resistance, Luo et al (2005b) identified genes in the resistant genotype that were more highly expressed than in the susceptible genotype (in response to Cercosporidium personatum infection) by microarray analysis and validated them by real-time PCR. In a recombinant inbred line (RIL) population (VG 9514 Â TAG 24), two transposable element (TE) markers, TE 360 and TE 498, were found to be associated with the rust resistance gene.…”

Strategies in Prevention of Preharvest Aflatoxin Contamination in Peanuts: Aflatoxin Biosynthesis, Genetics and Genomics

“…Macroarray (nylonbased) and microarray (glass slide-based) screening methods allow the simultaneous determination of expression levels of thousands of genes, making it possible to obtain a global view of the transcriptional state in a cell or tissue, and to associate genes with functions or specific physiological conditions. Recently, microarray technology has been demonstrated in a small scale pilot studies (Luo et al, 2005b;Luo et al, 2005c). EST-derived cDNA microarrays of 400 unigenes were probed under different conditions.…”