Identification of true <i>Gloiopeltis furcata</i> (Gigartinales, Rhodophyta) and preliminary analysis of its biogeography

Hanyuda, Takeaki; Yamamura, Kensho; Boo, Ga Hun; Miller, Kathy Ann; Vinogradova, K. L.; Kawai, Hiroshi

doi:10.1111/pre.12411

Cited by 4 publications

(5 citation statements)

References 36 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Currently, five Gloiopeltis species have been accepted from the NW Pacific region: G. tenax, G. complanata, G. furcata, G. frutex, and G. compressus (Yang and Kim 2018, Hanyuda et al 2019, Guiry and Guiry 2020. Our results provide the evidence of eleven different lineages within G. furcata s.l.…”

Section: Discussionmentioning

confidence: 99%

“…Despite the similar habitat of G. furcata s.l., they display different geographic distribution ranges based on the COI-5P gene. Gloiopeltis furcata s.s. is distributed in the temperate to cold water region, EAK of Korea and HOK, THK of Japan (Hanyuda et al 2019, Yang et al 2020. Gloiopeltis furcata s.s. is the only species of the genus known to be distributed in the East Pacific (Yang et al 2020).…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Phylogeography of Gloiopeltis furcata sensu lato (Gigartinales, Rhodophyta) provides the evidence of glacial refugia in Korea and Japan

Yang¹,

Fujita²,

Kim³

2021

ALGAE

View full text Add to dashboard Cite

The present-day genetic structure of macroalgal species reflects both geographical history and oceanic circulation patterns as well as anthropogenic introduction across native ranges. To precisely understand the genetic diversity and how the factors shape the current population structure of Gloiopeltis furcata sensu lato, we determined the mitochondrial 5′ end of cytochrome c oxidase subunit I (COI-5P) sequences for 677 individuals sampled from 67 sites spanning almost the entire distribution range in Korea and Japan. Results from the phylogenetic analysis and haplotype distribution revealed eleven distinct lineages within G. furcata s.l. along the Korea-Japan coastal areas and displayed divergent phylogeographic patterns among lineages. Despite the closely related lineages distributed in same habitats as high rocky intertidal zone, they display different phylogeographic patterns among lineages. The populations from the south of Korea-Japan harbored the highest genetic diversity and unique endemism in comparison with other populations in the distribution range. This could be the evidence of southern refugia for G. furcata s.l. in the Northwest (NW) Pacific and the recent migration from native to introduced region. The reason is that an exceptional distribution pattern was found high genetic diversity in Hakodate of Japan where is the northern location in the NW Pacific. Our results imply the contemporary influence on the distribution due to current circulation pattern and anthropogenic effects. These phylogeographic findings provide the important insight into cryptic species diversity and the detailed distribution pattern of Gloiopeltis in the NW Pacific.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

Phylogeography of Gloiopeltis furcata sensu lato (Gigartinales, Rhodophyta) provides the evidence of glacial refugia in Korea and Japan

Yang¹,

Fujita²,

Kim³

2021

ALGAE

View full text Add to dashboard Cite

show abstract

“…2004), rbcL‐Rh7 (Hanyuda et al . 2020), rbcLrevNEW (Saunders & Moore 2013), the newly designed DudrbclF1 (5′‐ATTATGCAGTTAAAGATACTG‐3′), DudrbclR1 (5′‐AATAACAGTACCAAGTTGC‐3′), DudrbclF2 (5′‐ATGTATGAAAGAGCTGAG‐3′) and DudrbclR2 (5′‐CACAAAGTCAGCTGTATC‐3′) for rbc L; and D28S1F (5′‐AGGTGTTGATTCATCGAGAC‐3′) and D28S4R (5′‐AACCCTTATCCCAAAGTTACG‐3′) for 28S. The PCR program consisted of a denaturation step at 94°C for 1 min, followed by 35 cycles of 98°C for 10 s, 50°C for 15 s and 68°C for 30 s, and a final elongation step at 68°C for 7 min.…”

Section: Methodsmentioning

confidence: 99%

“…Amplifications (PCRs) were performed using Tks Gflex DNA Polymerase (Takara Bio Inc., Otsu, Japan). The primers used were GazF1 and GazR1 (Saunders 2005) for cox1; F-57 (Freshwater & Rueness 1994), rbcL-Rh3 (Hanyuda et al 2004), rbcL-Rh7 (Hanyuda et al 2020), rbcLrevNEW (Saunders & Moore 2013), the newly designed DudrbclF1 (5 0 -ATTATGCAGTTAAAGATACTG-3 0 ), DudrbclR1 (5 0 -AATAAC AGTACCAAGTTGC-3 0 ), DudrbclF2 (5 0 -ATGTATGAAAGAGCTGA G-3 0 ) and DudrbclR2 (5 0 -CACAAAGTCAGCTGTATC-3 0 ) for rbcL; and D28S1F (5 0 -AGGTGTTGATTCATCGAGAC-3 0 ) and D28S4R (5 0 -AACCCTTATCCCAAAGTTACG-3 0 ) for 28S. The PCR program consisted of a denaturation step at 94 C for 1 min, followed by 35 cycles of 98 C for 10 s, 50 C for 15 s and 68 C for 30 s, and a final elongation step at 68 C for 7 min.…”

Section: Molecular Phylogenetic Analysesmentioning

confidence: 99%

Taxonomic study of the polyphyletic Dudresnaya (Dumontiaceae, Florideophyceae) with descriptions of Dudresnaya ryukyuensis sp. nov. and two new genera, Himehibirhodia and Nudresdaya

Hoshino,

Wakeman,

Kato

et al. 2024

Phycological Research

View full text Add to dashboard Cite

SUMMARYThe red algal genus Dudresnaya (Dumontiaceae, Gigartinales) has traditionally been a morphologically well‐defined taxon, but its molecular phylogeny has rarely been studied. To examine the phylogenetic relationships among Dudresnaya species, we generated new partial sequences of mitochondrial cox1, chloroplast rbcL and nuclear 28S rRNA genes from an undescribed Dudresnaya species from Okinawa Island, Japan, alongside five additional described species. Our phylogenetic analyses show that Dudresnaya is genetically diverse and polyphyletic. Based on molecular phylogeny and morphological data, we describe the Okinawan Dudresnaya as a new species, Dudresnaya ryukyuensis, and transferred Dudresnaya minima and Dudresnaya littleri, which were phylogenetically and morphologically distinct from the genuine Dudresnaya, to the new genera Himehibirhodia and Nudresdaya, respectively. Our phylogenetic analyses also showed that the Dumontiaceae is not a monophyletic group including the Gainiaceae and Rhizophyllidaceae (DGR complex). Considering that the DGR complex exhibits female reproductive structures and their post‐fertilization development that are similar to each other, the DGR complex appears to be recognized as the Dumontiaceae sensu lato.

show abstract

“…New molecular and morphological data have provided a taxonomic revision that includes the reinstatement of the genus Molecular marker-based phylogeographic analyses offer powerful approaches for tracking population and species histories [19]. Phylogeographic studies have recently been used to understand the population structure and demographic history of marine macroalgae in the NWP including red algae, Gelidium elegans [20], Chondrus ocellatus [2], Gloiopeltis furcata [21][22][23], and Agarophyton vermiculophyllum [24]. Brown algae in the NWP, such as Sargassum fusiforme [17] and Saccharina japonica [3], have also been characterized.…”

Section: Introductionmentioning

confidence: 99%

Population Genetic Structure and Phylogeography of Co-Distributed Pachymeniopsis Species (Rhodophyta) along the Coast of Korea and Japan

Yang

Kim

2021

Diversity

View full text Add to dashboard Cite

Inferring phylogeographic patterns of macroalgal species is essential for understanding the population structure and for the conservation of macroalgal species. In this study, the phylogeographic patterns of two co-distributed macroalgal species along the coast of Korea and Japan, Pachymeniopsis lanceolata and Pachymeniopsis elliptica, were analyzed. Pachymeniopsis lanceolata (215 specimens from 36 sites) and P. elliptica (138 specimens from 24 sites), using the plastid rbcL gene, are characterized by fifteen and six haplotypes, respectively. Mitochondrial COI-5P gene sequences revealed a low variation for both species. An analysis of molecular variance (AMOVA), pairwise FSTcomparisons, and haplotype networks based on the rbcL data suggest a weak genetic differentiation of both species. The shared haplotypes (P. lanceolata: LR01; P. elliptica: ER01) found in the entire sampling range indicate that these two Pachymeniopsis species can disperse over long distances along the coast of Korea and Japan. Despite the similar phylogeographic pattern, our results suggest that P. lanceolata has a higher genetic diversity, with a wider distribution along the Korean Peninsula than P. elliptica. Moreover, it is adapted to low sea surface temperatures and survived in more of the available habitats during periods of climatic change, whereas P. elliptica is less adaptable and more susceptible to environmental disturbance. This phylogeographic study provides a rationale for the conservation of the wild Pachymeniopsis population.

show abstract

Identification of true Gloiopeltis furcata (Gigartinales, Rhodophyta) and preliminary analysis of its biogeography

Cited by 4 publications

References 36 publications

Phylogeography of Gloiopeltis furcata sensu lato (Gigartinales, Rhodophyta) provides the evidence of glacial refugia in Korea and Japan

Phylogeography of Gloiopeltis furcata sensu lato (Gigartinales, Rhodophyta) provides the evidence of glacial refugia in Korea and Japan

Taxonomic study of the polyphyletic Dudresnaya (Dumontiaceae, Florideophyceae) with descriptions of Dudresnaya ryukyuensis sp. nov. and two new genera, Himehibirhodia and Nudresdaya

Population Genetic Structure and Phylogeography of Co-Distributed Pachymeniopsis Species (Rhodophyta) along the Coast of Korea and Japan

Contact Info

Product

Resources

About