Identification of upstream promoter elements mediating early transcription from the 35,000-molecular-weight protein gene of Autographa californica nuclear polyhedrosis virus

Abstract

Site-directed mutagenesis was used to examine the organization of cis-acting regulatory elements that comprise the promoter of the early 35,000-molecular-weight protein gene (35K protein gene) encoded by the EcoRI-S region of the baculovirus Autographa californica nuclear polyhedrosis virus. The promoter fragment, extending from positions-226 to +12 relative to the early RNA start site (position +1), was fused to the reporter gene encoding chloramphenicol acetyltransferase (CAT) and then inserted into the genome of recombinant viruses (3.96 map units) in order to ascertain the role of regulatory elements in the context of a normal infection. A combination of deletions and linker insertions revealed that early transcription was mediated by a basal (minimum) promoter, consisting of the TATA element (positions-30 to-25), that was in turn responsive to an upstream activating region located between-90 and-30. The TATA element exerted the single greatest influence on the level of early promoter activity and contained all information necessary to direct transcription from a site located 30 nucleotides downstream. The upstream activating region provided a 10to 15-fold stimulation of transcription from the early +1 start site that was mediated by distinct DNA elements. These regulatory elements included two GC motifs (centered at positions-81 and-54, respectively), composed of alternating G and C residues, and a CGT motif (position-40) that contained the core sequence A(A/T)CGT(G/T). Each motif was required for full promoter activity during the early phase of infection. This organization that employs diverse cis-acting stimulatory elements is typical of promoters responsive to RNA polymerase II and may facilitate increased expression of A. californica nuclear polyhedrosis virus genes early in infection when the level of viral DNA for transcription is critically low.

Analysis of a mosquito acetylcholinesterase gene promoter

“…The exact location of the transcription start point was then determined by primer extension analysis. Primer extension was performed on 30 mg of adult polyA+ RNA using a third primer (end-labelled at 115 6 10 4 cpm) starting at position 175 from the 5' end of cDNA1 (gsp-3; sequence, TTTTTCCTTTGCCTGCGGTGTTTTCC) as described elsewhere (Nissen & Friesen, 1989;Dickson & Friesen, 1991). The corresponding sequencing ladder was generated as described above, also using gsp-3 as a primer and gc-5 as the template.…”

DNA-dependent transregulation by IE1 of Autographa californica nuclear polyhedrosis virus: IE1 domains required for transactivation and DNA binding

“…CAT assays. Freeze-thaw extracts from plasmid-transfected SF21 cells were assayed for CAT as described previously (10). Acetylation of [ 14 C]chloramphenicol was quantified by using a PhosphorImager (Molecular Dynamics).…”

“…1B). The minimal p35 basal promoter contains a TATA element and early RNA start site (ϩ1) but lacks its viral upstream activating region (10,39,44).…”

Characterization of recombinant epidermal growth factor (EGF)‐like modules from vitamin‐K‐dependent protein S expressed in Spodoptera cells

“…Leupeptin, trypsin (treated with tosylphenylalanylchlormethane) neutral red, nitro blue tetratrazolium, A. californica nuclear polyhedrosis virus DNA was cotransfected with baculovirus transfer vectors into SF 21 cells with phenylmethylsulfonyl fluoride and 5-bromo-chloro-3-indolyl phosphate were from Sigma. Diisopropyl fluorophosphate and lipofectin [20]. The cells were grown in TC 100 medium containing 10% fetal calf serum.…”

“…Recombinant viruses were plaque purified three times and pass 2 virus stocks were made, before infection Chelex 100 resin 200Ϫ400 mesh (sodium form) was from Bio-Rad. Chemicals for amino acid analysis were obtained from of SF 9 cells the stocks were titrated [20,21].…”