IL28B Polymorphism Correlates with Active Hepatitis in Patients with HBeAg-Negative Chronic Hepatitis B

Abstract

Background & AimsThe clinical relevance of single nucleotide polymorphisms (SNPs) near the IL28B gene is controversial in patients with hepatitis B virus (HBV) infection. This study aimed to investigate the role of viral and host factors, including IL28B genotypes, in the natural course of chronic hepatitis B (CHB).MethodsThe study enrolled consecutive 115 treatment-naive CHB patients. HBV viral loads, genotypes, precore and basal core promotor mutations, serum hepatitis B surface antigen (HBsAg) and interferon-gamma inducible protein 10 (IP-10) levels as well as four SNPs of IL28B were determined. Serial alanine transaminase (ALT) levels in the previous one year before enrollment at an interval of three months were recorded. Factors associated with active hepatitis, defined as persistent ALT >2× upper limit of normal (ULN) or a peak ALT level >5× ULN, were evaluated.ResultsThe prevalence of rs8105790 TT, rs12979860 CC, rs8099917 TT, and rs10853728 CC genotypes were 88.3%, 87.4%, 88.4% and 70.9%, respectively. In HBeAg-positive patients (n = 48), HBV viral load correlated with active hepatitis, while in HBeAg-negative patients (n = 67), rs10853728 CC genotype (p = 0.032) and a trend of higher IP-10 levels (p = 0.092) were associated with active hepatitis. In multivariate analysis, high viral load (HBV DNA >108 IU/mL, p = 0.042, odds ratio = 3.946) was significantly associated with HBeAg-positive hepatitis, whereas rs10853728 CC genotype (p = 0.019, odds ratio = 3.927) was the only independent factor associated with active hepatitis in HBeAg-negative population.ConclusionsHBV viral load and IL28B rs10853728 CC genotype correlated with hepatitis activity in HBeAg-positive and HBeAg-negative CHB, respectively. Both viral and host factors play roles in disease activity during different phases of CHB.

Interleukin 28B Genetic Polymorphism and Spontaneous Recovery from Hepatitis B Virus Infection in an Iranian Azeri Population

“…However, this similarity is not restricted to inhabitants of Azerbaijan province yet are reported from other parts of Iran as well (19,26). Fewer data are available about polymorphism in rs8099917, and comparable to the current results; rs8099917TT is the most common (13,14,20). Though this dominance is more obvious in some report, rs8099917GG was not detected in a Korean sample (27).…”

“…In several studies from Hong Kong (20), Australia (21), Korea (13,14), and China (22), rs12979860CC was the most common genotype regardless of hepatitis infection status with a noticeable difference to other genotypes. This difference decreased in studies from Arabian countries (23) where rs12979860CC was still foremost.…”

CXCL9 Associated with Sustained Virological Response in Chronic Hepatitis B Patients Receiving Peginterferon Alfa-2a Therapy: A Pilot Study

“…Four SNPs of IL28B including rs8105790, rs12979860, rs8099917 and rs10853728 were chosen according to previous reports and our study [4,25–28,31]. The genotype of rs12979860 was tested using TaqMan custom-designed rs12979860 probes (Applied Biosystems, Foster City, CA; forward primer GCCTGTCGTGTACTGAACCA, reverse primer GCGCGGAGTGCAATTCAAC, and the probes TGGTTCGCGCCTTC [VIC] and CTGGTTCACGCCTTC [FAM], respectively) [32].…”

“…The spectrum and the natural course of chronic HBV infection are diverse and variable, ranging from an inactive carrier state to progressive chronic hepatitis B (CHB), which may evolve to hepatic decompensation, cirrhosis and hepatocellular carcinoma (HCC) [2]. Both host and viral factors play critical roles in the natural history of CHB, disease activity as well as efficacies of antiviral therapies [3,4]. Impaired host immune response against HBV is commonly observed in patients with CHB, which might be related to persistent high viral loads with subsequent T cell exhaustion [5].…”

“…In patients with hepatitis C virus (HCV) infection, lower baseline and on-treatment IP-10 levels may predict a higher rate of virological response to IFN-based therapy [20–22]. Recently, we also demonstrated a correlation of IP-10 with higher hepatitis activity in patients with CHB [4]. Pro-inflammatory cytokines interferon-gamma (IFN-γ) and transforming growth factor beta (TGF-β) may also have roles in suppressing HBV replication [1,23,24].…”