Illumina MiSeq sequencing analysis of fungal diversity in stored dates

Al-Bulushi, Ismail M.; Bani-Uraba, Muna S.; Guizani, Nejib; Al-Khusaibi, Mohammed; Al-Sadi, Abdullah M.

doi:10.1186/s12866-017-0985-7

Cited by 30 publications

(29 citation statements)

References 32 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Separation of samples based on Unweighted UniFrac distances gives an indication that fungal communities in each place are different to some extent from fungal communities from other places. The effects of location on the type of fungal taxa has been observed in other studies with other crops 52 , 53 .…”

Section: Discussionsupporting

confidence: 67%

“…These included Glomus and Zopfiella 30 , 32 , 54 . MiSeq is a powerful tool in the analysis of fungal communities, and it has been used previously for the detection and estimation of fungal diversity in several plant roots, leaves and stems 52 , 54 – 56 .…”

Section: Discussionmentioning

confidence: 99%

“…The 17 DNA samples were subjected to Illumina MiSeq analysis (MISeq ITS1 assay; 10 K). Firstly, samples were amplified using the forward primer constructed from Illumina i5 sequencing primer (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG) and the ITS1F primer (CTTGGTCATTTAGAGGAAGTAA) 58 and the reverse primer constructed from Illumina i7 sequencing primer (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) and ITS2aR primer (GCTGCGTTCTTCATCGATGC) 52 , 59 . The PCR reaction mixture consisted of DNA, 1 µl of each 5 µM primer and Qiagen HotStar Taq master mix (Qiagen Inc, Valencia, California).…”

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

Illumina-MiSeq analysis of fungi in acid lime roots reveals dominance of Fusarium and variation in fungal taxa

Al-Sadi

Kazerooni

2018

Sci Rep

Self Cite

View full text Add to dashboard Cite

A study was conducted to analyze fungal diversity in the roots of acid lime (Citrus aurantifolia) collected from Oman, a semi-arid country located in the South Eastern part of the Arabian Peninsula. MiSeq analysis showed the Ascomycota and Sordariomycetes were the most abundant phylum and class in acid lime roots, respectively. Glomeromycota, Basidiomycota and Microsporidia were the other fungal phyla, while Glomeromycetes and some other classes belonging to Ascomycota and Basidiomycota were detected at lower frequencies. The genus Fusarium was the most abundant in all samples, making up 46 to 95% of the total reads. Some fungal genera of Arbuscular mycorrhizae and nematophagous fungi were detected in some of the acid lime roots. Analysis of the level of fungal diversity showed that no significant differences exist among groups of root samples (from different locations) in their Chao richness and Shannon diversity levels (P < 0.05). Principle component analysis of fungal communities significantly separated samples according to their locations. This is the first study to evaluate fungal diversity in acid lime roots using high throughput sequencing analysis. The study reveals the presence of various fungal taxa in the roots, dominated by Fusarium species and including some mycorrhizae and nematophagous fungi.

show abstract

Section: Discussionsupporting

confidence: 67%

Section: Discussionmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Illumina-MiSeq analysis of fungi in acid lime roots reveals dominance of Fusarium and variation in fungal taxa

Al-Sadi

Kazerooni

2018

Sci Rep

Self Cite

View full text Add to dashboard Cite

show abstract

“…Firstly, the forward (i5 and ITS1F) and reverse (i7 and ITS2aR) primers were constructed as described previously ( White et al, 1990 ; Gardes and Bruns, 1993 ; Kazeeroni and Al-Sadi, 2016 ; Al-Balushi et al, 2017 ). The reaction mixtures and conditions for the first and the second PCRs were as per Al-Balushi et al (2017) . Checking of sequences was done using RDP ver 9 ( Cole et al, 2009 ).…”

Section: Methodsmentioning

confidence: 99%

Fungal Diversity in Tomato Rhizosphere Soil under Conventional and Desert Farming Systems

et al. 2017

Self Cite

View full text Add to dashboard Cite

This study examined fungal diversity and composition in conventional (CM) and desert farming (DE) systems in Oman. Fungal diversity in the rhizosphere of tomato was assessed using 454-pyrosequencing and culture-based techniques. Both techniques produced variable results in terms of fungal diversity, with 25% of the fungal classes shared between the two techniques. In addition, pyrosequencing recovered more taxa compared to direct plating. These findings could be attributed to the ability of pyrosequencing to recover taxa that cannot grow or are slow growing on culture media. Both techniques showed that fungal diversity in the conventional farm was comparable to that in the desert farm. However, the composition of fungal classes and taxa in the two farming systems were different. Pyrosequencing revealed that Microsporidetes and Dothideomycetes are the two most common fungal classes in CM and DE, respectively. However, the culture-based technique revealed that Eurotiomycetes was the most abundant class in both farming systems and some classes, such as Microsporidetes, were not detected by the culture-based technique. Although some plant pathogens (e.g., Pythium or Fusarium) were detected in the rhizosphere of tomato, the majority of fungal species in the rhizosphere of tomato were saprophytes. Our study shows that the cultivation system may have an impact on fungal diversity. The factors which affected fungal diversity in both farms are discussed.

show abstract

“…As Illumina has a restricted read length, diversity studies have been limited to an amplicon maximum of approximately 450 bp. A result of this being that studies have either focused on short hypervariable regions of 18S rRNA [ 25 – 27 ], ITS [ 28 , 29 ], or 28s rRNA [ 30 , 31 ]. These regions, despite being variable, sometimes lack enough sequence variation to be able to divide some genera to the species level.…”

Section: Introductionmentioning

confidence: 99%

Enigmatic Diphyllatea eukaryotes: culturing and targeted PacBio RS amplicon sequencing reveals a higher order taxonomic diversity and global distribution

et al. 2018

View full text Add to dashboard Cite

BackgroundThe class Diphyllatea belongs to a group of enigmatic unicellular eukaryotes that play a key role in reconstructing the morphological innovation and diversification of early eukaryotic evolution. Despite its evolutionary significance, very little is known about the phylogeny and species diversity of Diphyllatea. Only three species have described morphology, being taxonomically divided by flagella number, two or four, and cell size. Currently, one 18S rRNA Diphyllatea sequence is available, with environmental sequencing surveys reporting only a single partial sequence from a Diphyllatea-like organism. Accordingly, geographical distribution of Diphyllatea based on molecular data is limited, despite morphological data suggesting the class has a global distribution. We here present a first attempt to understand species distribution, diversity and higher order structure of Diphyllatea.ResultsWe cultured 11 new strains, characterised these morphologically and amplified their rRNA for a combined 18S–28S rRNA phylogeny. We sampled environmental DNA from multiple sites and designed new Diphyllatea-specific PCR primers for long-read PacBio RSII technology. Near full-length 18S rRNA sequences from environmental DNA, in addition to supplementary Diphyllatea sequence data mined from public databases, resolved the phylogeny into three deeply branching and distinct clades (Diphy I – III). Of these, the Diphy III clade is entirely novel, and in congruence with Diphy II, composed of species morphologically consistent with the earlier described Collodictyon triciliatum. The phylogenetic split between the Diphy I and Diphy II + III clades corresponds with a morphological division of Diphyllatea into bi- and quadriflagellate cell forms.ConclusionsThis altered flagella composition must have occurred early in the diversification of Diphyllatea and may represent one of the earliest known morphological transitions among eukaryotes. Further, the substantial increase in molecular data presented here confirms Diphyllatea has a global distribution, seemingly restricted to freshwater habitats. Altogether, the results reveal the advantage of combining a group-specific PCR approach and long-read high-throughput amplicon sequencing in surveying enigmatic eukaryote lineages. Lastly, our study shows the capacity of PacBio RS when targeting a protist class for increasing phylogenetic resolution.Electronic supplementary materialThe online version of this article (10.1186/s12862-018-1224-z) contains supplementary material, which is available to authorized users.

show abstract

Illumina MiSeq sequencing analysis of fungal diversity in stored dates

Cited by 30 publications

References 32 publications

Illumina-MiSeq analysis of fungi in acid lime roots reveals dominance of Fusarium and variation in fungal taxa

Illumina-MiSeq analysis of fungi in acid lime roots reveals dominance of Fusarium and variation in fungal taxa

Fungal Diversity in Tomato Rhizosphere Soil under Conventional and Desert Farming Systems

Enigmatic Diphyllatea eukaryotes: culturing and targeted PacBio RS amplicon sequencing reveals a higher order taxonomic diversity and global distribution

Contact Info

Product

Resources

About