Immunohistologic identification of phenotypic antigens associated with Hodgkin and reed-sternberg cells. A paraffin section study

Abstract

A combination of two monoclonal antibodies, designated LN-1 and LN-2, were used in an attempt to identify the corresponding antigens in Hodgkin and Reed-Sternberg cells. The LN-1 antibody has been shown in previous studies in our laboratories to identify follicular center cells, whereas LN-2 marks certain B-cell subpopulations as well as interfollicular histiocytes. Utilizing the perioxidase-antipenoxidase (PAP) technique, paraffin-embedded sections were examined representing 39 cases of various histologic subgroups of Hodgkin's lymphoma following immunostaining with LN-1, LN-2, and the antibody to S-100. Of these 39 cases, the LN-2 antibody was found to consistently mark the majority of Hodgkin and Reed-Sternberg cells. LN-1 was found to identify Hodgkin and Reed-Sternberg cells in a smaller number of cases. In no instance were Hodgkin or Reed-Sternberg cells found to mark for the S-100 protein. The use of LN-1 and LN-2 antibodies facilitated the identification of Hodgkin and Reed-Stemberg cells and produced additional information regarding the phentotypic nature of these cells.

Characterization of giant cells in Hodgkin's lymphomas by immunohistochemistry applied to randomly collected diagnostic biopsies from the german Hodgkin trial

“…There is little variance from recent reports concerning the percentage of positive staining with anti-CD15 antibodies, although smaller (Ree et al, 1989) and larger percentages of (Chittal et al, 1988;Dorfman et al, 1986; positive cases have been reported. Differences are also reported with the monoclonal antibodies Ber-H2 (Chittal et al, 1988;Ree et al, 1989;Schwarting et al, 1989), especially in the mixed cellularity type (Hall et al, 1988), and LN-2 (Sherrod et al, 1986;Chittal et al, 1988;Ree et al, 1989). The discordant results among different authors may result from technical differences or depend in part on the small numbers of cases examined (Sherrod et al, 1986;Hall et al, 1988).…”

“…Differences are also reported with the monoclonal antibodies Ber-H2 (Chittal et al, 1988;Ree et al, 1989;Schwarting et al, 1989), especially in the mixed cellularity type (Hall et al, 1988), and LN-2 (Sherrod et al, 1986;Chittal et al, 1988;Ree et al, 1989). The discordant results among different authors may result from technical differences or depend in part on the small numbers of cases examined (Sherrod et al, 1986;Hall et al, 1988). Apart from the three antibodies mentioned above, the lectin peanut agglutinin has proved a useful marker for RSC and HC (Moller, 1982;Ree et al, 1989).…”

“…Since monoclonal antibodies (MAB) which stain formalin-resistant epitopes in paraffinembedded tissues have been developed (Stein et af., 1982a;Norton et al, 1986Norton et al, , 1987Epstein et al, 1984;Poppema et al, 1987), several approaches have been used to detect staining patterns in Hodgkin's lymphomas (Stein et al, 1982a,b;Sherrod et al, 1986;Dorfman et al, 1986;Chittal et al, 1988;Hall et al, 1988;Ree et al, 1989). There has been little disagreement among these various approaches, especially concerning the percentage of positive reactions of Reed-Sternberg cells (RSC) and Hodgkin cells (HC) to the MAB Ber-H2 and LN-2 (Hall et at., 1988;Chittal et at., 1988;Ree et af., 1989).…”

Clinical features associated with transformation of cerebriform T‐cell lymphoma to a large cell process

“…The lesions in cutaneou5 Hodgkin's disease are often papular or nodular and may progress to ulcerate similar to transformed CTCL; however, cutaneous Hodgkin's disease is usually seen in proximity to pathologic adenopathy (Smith and Butler, 1980). Expression of the markers LeuM 1, Ki-1, and LN2 may be found in RS cells and transformed T cells, but the use of LCA and UCHLl may allow differentiation of these two processes in most cases (Pinkus et al, 1985;Linden et al, 1987;Hsu and Jaffe, 1984;Sherrod et al, 1986;Hsu et al, 1985;Casey et al, 1986b). In both of our cases with coexistent transformed CTCL and Hodgkin's disease, large transformed T cells reacted with both UCHL 1 and LCA while RS cells were negative.…”

Concordance for Hodgkin's Disease in Identical Twins Suggesting Genetic Susceptibility to the Young-Adult Form of the Disease

“…When adequate samples were available, the phenotype of Reed-Sternberg cells and background lymphocytes was determined with standard immunoperoxidase techniques. 20 Specimens from the pairs of twins concordant for disease were evaluated for evidence of EBV with the polymerase chain reaction to detect viral DNA sequences (with primers SL1 5 Ј GGACCTCAAAGAAGAGGGGG and SL3 GCTCCTGGTCTTCCGCCTCC and a probe specific for EBV nuclear antigen 1, SL2 GGACGAGGACGGGGAAGAGG), or by a method that is at least as sensitive, in situ hybridization (with a 30base sequence, 5 Ј AGACACCGTCCTCACCACCCGGGACTTGT-A3 Ј , complementary to a portion of the EBER-1 gene that is actively transcribed in latently infected cells). 7 In some cases both methods were used.…”