Impact of a conservation agriculture system on soil characteristics, rice yield, and root-parasitic nematodes in a Cambodian lowland rice field

Abstract

Rice production in Southeast Asia is significantly affected by root-parasitic nematodes (RPN). The Green Revolution has encouraged new agricultural practices (e.g. intensive monoculture, high yielding rice variety) to respond to the high rice demand; however, these methods have promoted the spread of these pests. The recent banning of chemical nematicides resulted in a need for alternative sustainable control strategies. In the present study, we assessed the effects of a direct-seeding mulch-based cropping system (DMC) vs conventional plough-based tillages (CT) on soil properties, rice yield and RPN communities during a two-year trial in Cambodia. Our results show that on average the population densities of RPN were significantly higher in DMC than in CT. Molecular identification revealed only two RPN species associated with roots: Meloidogyne graminicola, not previously reported from Cambodia, was predominant and was present throughout the plant's development, whereas Hirschmanniella mucronata was only found at the tillering and milky stages. We conclude that DMC had a significant positive impact on rice yield, despite higher RPN short-term pressure. In order to increase the efficiency of such cropping systems, further studies and an evaluation of the long-term relationships between DMC, the nature of cover crops used, the soil biota including RPN, and rice yield should be conducted.

Incidence and Characterization of Rice Root Nematodes, Hirschmanniella mucronata, from Rice Fields in Pathum Thani Province, Thailand

“…The age of rice and soil pH might influence nematode abundance, where greater numbers of nematodes extracted from rice stubbles were observed at soil pH 5.9 -6.0 than soil pH 5.3 -5.4. These results were similar to those reports by [11,18,20] who examined Hirschmanniella populations in paddy rice fields of Takeo, Battambang and Kampong Thom provinces, Cambodia. In addition, as Hirschmanniella are migratory endoparasites by nature, they are more prevalent in rice roots than in soil [21].…”

“…The PCR was conducted by using extracted nematode DNA as the template. 30 µL of PCR reaction included 3 µL of DNA template, 9 µL of sterilized distilled water, 1.5 µL of each 10 µM forward and reverse primers {D2A (5′ ACAAGTACCGTGAGGGAAAGT 3′) and D3B (5′ TGCGAAGGAACCAGCTACTA 3′) [17] and rDNA2 (5'-TTGATTACGTCCCTGCCCTTT-3') and rDNA1.58s (5'-ACGAGCCCGAGTGATCCACCG-3') [18]}, and 15 µL of 2x PCR master mix with dye solution i-taq (Intron biotechnology, Korea). The PCR condition was programmed as follows: denaturation at 94 °C for 5 min, followed by 35 cycles of 94 °C for 30 s, 56 °C for 30 s and 72 °C for 1 min, and final extension at 72 °C for 5 min.…”

Co-implementation of conservation tillage and herbicides reduces weed and nematode infestation and enhances the productivity of direct-seeded rice in North-western Indo-Gangetic Plains

“…Puddling could significantly reduce nematodes in PTR, while nematodes such as RKN, Meloidogyne triticoryzae, and Tylenchorhynchus mashoodi were higher in DSR (Gaur and Singh, 1993;Chandel et al, 2002). Similarly, Suong et al (2019) found higher root-parasitic nematodes in rice under direct-seeded mulch-based cropping system than in conventional plow-based tillage in Cambodia. The populations of Tylenchorhynchus brevilineatus and Pratylenchus spp were significantly higher in ZT than in CT fields (Pankaj et al, 2006).…”

Diachronic assessment of soil organic C and N dynamics under long-term no-till cropping systems in the tropical upland of Cambodia

“…Cambodian soils are seriously threatened by inappropriate agricultural systems. The returns on taking actions against land degradation are estimated at 3 US dollars for every dollar invested in restoring cropping systems on soil health, and SOC sequestration have been reported in several studies (Hok et al, 2015(Hok et al, , 2018(Hok et al, , 2021Pheap et al, 2019;Suong et al, 2019;Sar, 2021;Koun et al, 2023), however, the information on the impact of long-term NT systems on the changes in SOC stock remains scarce in the country as well as in Southeast Asia. There is a need to document the long-term changes in SOC stocks under CA and NT cropping systems to fill in the knowledge gaps as well as provide robust evidences to land use planners and policymakers.…”