Impact of mild heat stress on dry matter intake, milk yield and milk composition in mid-lactation Holstein dairy cows in a temperate climate

Gorniak, Tobias; Meyer, Ulrich; Südekum, Karl‐Heinz; Dänicke, Sven

doi:10.1080/1745039x.2014.950451

Cited by 82 publications

(65 citation statements)

References 26 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Links between production and heat stress have been demonstrated previously [16]. Both the consumption of dry matter (DM) and milk production decrease when the temperature humidity index (THI) was >60 [17]. Furthermore, water consumption increases linearly under mild heat stress when THI exceeds 30 [17] and hence daily water use fluctuations are typically greater in summer months [18].…”

Section: Introductionmentioning

confidence: 99%

“…Both the consumption of dry matter (DM) and milk production decrease when the temperature humidity index (THI) was >60 [17]. Furthermore, water consumption increases linearly under mild heat stress when THI exceeds 30 [17] and hence daily water use fluctuations are typically greater in summer months [18]. Heat stress mitigation, such as cow showers, can decrease cow body temperature by 0.2 • C and showered cows spend half as much time near water bowls [19].…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Water Use and Conservation on a Free-Stall Dairy Farm

Riche

VanderZaag

Burtt

et al. 2017

Water

View full text Add to dashboard Cite

Livestock watering can represent as much as 20% of total agricultural water use in areas with intensive dairy farming. Due to an increased emphasis on water conservation for the agricultural sector, it is important to understand the current patterns of on-farm water use. This study utilized in situ water meters to measure the year-round on-farm pumped water (i.e., blue water) on a~419 lactating cow confined dairy operation in Eastern Ontario, Canada. The average total water use for the farm was 90,253 ± 15,203 L day −1 and 33,032 m 3 annually. Water use was divided into nutritional water (68%), parlour cleaning and operation (14%), milk pre-cooling (15%), barn cleaning, misters and other uses (3%). There was a positive correlation between total monthly water consumption (i.e., nutritional water) and average monthly temperature for lactating cows, heifers, and calves (R 2 = 0.69, 0.84, and 0.85, respectively). The blue water footprint scaled by milk production was 6.19 L kg −1 milk or 6.41 L kg −1 fat-and-protein corrected milk (FPCM) including contributions from all animal groups and 5.34 L kg −1 milk (5.54 L kg −1 FPCM) when excluding the water consumption of non-lactating animals. By applying theoretical water conservation scenarios we show that a combination of strategies (air temperature reduction, complete recycling of milk-cooling water, and modified cow preparation protocol) could achieve a savings of 6229 m 3 annually, a~19% reduction in the total annual water use.

show abstract

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Water Use and Conservation on a Free-Stall Dairy Farm

Riche

VanderZaag

Burtt

et al. 2017

Water

View full text Add to dashboard Cite

show abstract

“…According to Gorniak et al (2), even mild heat stress in cows kept in a temperate climate negatively affects milk production. Moreover, the decline in performance they observed could not be explained solely by reduced feed intake, and other factors, including changes in energy metabolism, might have contributed to decreased milk yield (2). At the physiological level, a hot environment was shown to induce several adaptive responses, including alterations of lipid metabolism (3).…”

mentioning

confidence: 99%

“…The negative influence of elevated environmental temperatures on economically important traits is well recognized in cattle. Thermal stress is responsible for decreased milk yield, milk fat, and protein contents, as well as reduced dry matter intake, health, and fertility (1,2). According to Gorniak et al (2), even mild heat stress in cows kept in a temperate climate negatively affects milk production.…”

mentioning

confidence: 99%

The effect of DGAT1 polymorphism on milk production traits in dairycows depending on environmental temperature

Komisarek¹,

Kolenda²

2016

Turk J Vet Anim Sci

View full text Add to dashboard Cite

Heat stress is a growing problem in dairy cattle breeding because of global warming and because of the genetic selection for greater production that reduces thermotolerance in cows. The negative influence of elevated environmental temperatures on economically important traits is well recognized in cattle. Thermal stress is responsible for decreased milk yield, milk fat, and protein contents, as well as reduced dry matter intake, health, and fertility (1,2). According to Gorniak et al. (2), even mild heat stress in cows kept in a temperate climate negatively affects milk production. Moreover, the decline in performance they observed could not be explained solely by reduced feed intake, and other factors, including changes in energy metabolism, might have contributed to decreased milk yield (2). At the physiological level, a hot environment was shown to induce several adaptive responses, including alterations of lipid metabolism (3).Acyl-coenzyme A:diacylglycerol transferase (DGAT1) is a lipogenic enzyme that plays a key role in the synthesis of triacylglycerols (4). An ApA to GpC dinucleotide substitution located in exon 8 of the bovine DGAT1 gene that replaces lysine (K) by alanine (A) in encoded protein (K232A polymorphism) has been proven to have a pronounced influence on milk yield and composition, especially on fat percentage in milk (5-7). Although in many cattle populations DGAT1:p.K232A alleles affected individual milk traits in the same direction, the magnitude of effects was variable between breeds (8), and during lactation (9). Recently, Akbar et al. (10) reported that the expression of this gene in the liver is reduced during the hot season. However, the impact of seasonal ambient air temperature changes on DGAT1 polymorphism effects is not known so far. The aim of this study was, therefore, to establish if the influence of K232A on milk production traits is dependent on environmental thermal conditions.The analyzed data set comprised 468 dairy cows of the Polish Holstein-Friesian (HF) breed, born between 1999 and 2002, and kept on the same farm under uniform environmental conditions. The animals were daughters of 109 sires, with the sire half-sib family sizes varying between 1 and 53. The average cow's milk yield per 305day lactation was 7452 kg.DNA for molecular analyses was extracted from peripheral blood using the standard phenol method. The biological material was collected in accordance with the ethical standards of the Local Ethics Committee for Animal Research. Genotypes of DGAT1:p.K232A were determined using the PCR-RFLP method, as described by Szyda and Komisarek (11), with the use of the following primers (5'-3'): F:TGCCGCTTGCTCGTAGCTTTGGCC* and

show abstract

“…Even though the physiological mechanisms are unclear, it is believed that these metabolic modifications under heat stress during lactation account for approximately 50% of the milk production loss observed (6), whereas decreased dry matter intake (DMI) explains the remainder of the depressed milk yield (16). Also, it was found that the stage of lactation has a negative influence on milk production under the environmental condition of heat stress (17).…”

Section: Discussionmentioning

confidence: 99%

The Effect of Thermal Environment on Daily Milk Yield of Dairy Cows

Trajchev

Nakov

Andonov

2016

Macedonian Veterinary Review

View full text Add to dashboard Cite

Macedonian Veterinary ReviewThe primary objective of this research was to evaluate the impact of environmental air temperatures on the milk production of dairy cows. Therefore, the experiment was carried out at the height of summer (from 15 th of June to 15 th of September) in three small family dairy farms and one commercial dairy farm. In total, 51 dairy cows from the black-white breed were subjected to the study. The season of research was divided into three periods: the period before the hot season, the period of the hot season and the period after the hot season. In each period there were three test days selected that were used for recording the air temperature inside and outside the barns and cow's daily milk yield. Unvaried associations between the test day milk yield of cows and independent environmental and cow factors were done using the linear mixed model for repeated measurements. The statistical model showed that the farm management system and the hot season of the year had significant infl uence on daily milk yield per cow at the level of p<0.001. The test day per periods of the season when milk control was performed and the average test day environmental temperature showed statistically significant influence on daily milk yield per cow at level p<0.01. The present results revealed that environmental air temperatures contributes to considerable loss in the milk production of dairy cows.Key words: dairy cow, environmental heat stress, milk yield INTRODUCTIONOver the past decades, improvements in genetic selection for milk production together with good management practices have resulted in increased milk production per cow (1). Historically, genetic selection for increased milk production has resulted in reduced thermal tolerance. Moreover, higher milk production is increasing the rate of metabolic heat production due to an increased eating and drinking behavior, making the high yielding cows more vulnerable to heat stress than lower yielding ones (2, 3). Environmental conditions, such as high air temperature and solar radiation are the main stress factors for dairy cows (4). The etiology of heat stress consists in the failure to maintain core body thermo-neutrality in conditions of increasing ambient temperature and humidity. Exposure of dairy cows to a thermal environment is a major risk factor for decreased milk production, especially in high-yielding cows more than in low-yielding ones (2, 5) due to the combined accumulation of heat gained from the environment and metabolic heat. As body temperature rises, the cow enters heat stress. Consequently, in relation to the eating behavior in a hot environment, characterized by lowering feed consumption and increasing water intake as a result of metabolic adaptation to increased body Unauthenticated Download Date | 5/12/18 4:08 AM 186 temperature, high producing dairy cows in early lactation are more sensitive to heat stress and their milk production declines significantly (6). When dairy cows are under heat stress, the accumulated heat exceeds the body...

show abstract

Impact of mild heat stress on dry matter intake, milk yield and milk composition in mid-lactation Holstein dairy cows in a temperate climate

Cited by 82 publications

References 26 publications

Water Use and Conservation on a Free-Stall Dairy Farm

Water Use and Conservation on a Free-Stall Dairy Farm

The effect of DGAT1 polymorphism on milk production traits in dairycows depending on environmental temperature

The Effect of Thermal Environment on Daily Milk Yield of Dairy Cows

Contact Info

Product

Resources

About