Impact of two different colistin dosing strategies on healthy piglet fecal microbiota

Fleury, Mickaël; Jouy, Éric; Eono, F.; Cariolet, Roland; Couet, William; Gobin, Patrice; Goff, Olivier Le; Blanquet‐Diot, Stéphanie; Alric, Monique; Kempf, Isabelle

doi:10.1016/j.rvsc.2016.06.003

Cited by 20 publications

(25 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…parameters subsequent to CS use in the post-weaning period in pigs [78,79]. In order to evaluate the effect of colistin on fecal E. coli shedding, bacterial quantification was performed in most studies using culture methods [28,77], whereas other studies used real-time PCR [79,80]. Furthermore, the oral use of a high dose of colistin in healthy piglets was not associated with a major perturbation in the pig gut microbiota as demonstrated by a high-throughput sequencing method [80].…”

Section: Microbiological and Clinical Outcomes Of Colistin Use In Conmentioning

confidence: 99%

Post weaning diarrhea in pigs: risk factors and non-colistin-based control strategies

et al. 2017

View full text Add to dashboard Cite

Post-weaning diarrhea (PWD) is one of the most serious threats for the swine industry worldwide. It is commonly associated with the proliferation of enterotoxigenic Escherichia coli in the pig intestine. Colistin, a cationic antibiotic, is widely used in swine for the oral treatment of intestinal infections caused by E. coli, and particularly of PWD. However, despite the effectiveness of this antibiotic in the treatment of PWD, several studies have reported high rates of colistin resistant E. coli in swine. Furthermore, this antibiotic is considered of very high importance in humans, being used for the treatment of infections due to multidrug-resistant (MDR) Gram-negative bacteria (GNB). Moreover, the recent discovery of the mcr-1 gene encoding for colistin resistance in Enterobacteriaceae on a conjugative stable plasmid has raised great concern about the possible loss of colistin effectiveness for the treatment of MDR-GNB in humans. Consequently, it has been proposed that the use of colistin in animal production should be considered as a last resort treatment only. Thus, to overcome the economic losses, which would result from the restriction of use of colistin, especially for prophylactic purposes in PWD control, we believe that an understanding of the factors contributing to the development of this disease and the putting in place of practical alternative strategies for the control of PWD in swine is crucial. Such alternatives should improve animal gut health and reduce economic losses in pigs without promoting bacterial resistance. The present review begins with an overview of risk factors of PWD and an update of colistin use in PWD control worldwide in terms of quantities and microbiological outcomes. Subsequently, alternative strategies to the use of colistin for the control of this disease are described and discussed. Finally, a practical approach for the control of PWD in its various phases is proposed.

show abstract

Section: Microbiological and Clinical Outcomes Of Colistin Use In Conmentioning

confidence: 99%

Post weaning diarrhea in pigs: risk factors and non-colistin-based control strategies

et al. 2017

View full text Add to dashboard Cite

show abstract

“…In this study, no difference was observed between the CS treated and the control group in terms of average daily gain per day (ADG/day), Fleury M etl., 2016 [5]. Also, the economic benefits of antimicrobial growth promotion in modern farms have been questioned [6,12,13], the benefit of this use being associated with poor hygiene on farms.…”

Section: Discussionmentioning

confidence: 99%

Effect of Biofat on Growing Performance and Health Status of Post-Weaning Piglets

2019

Asp Biomed Clin Case Rep

View full text Add to dashboard Cite

BioFAT is a bioproduct contained PUFAs, Se, Vitamin E and herb (Euphorbia thymifolia Burm (L.)). Data were conducted on experiments of added 2 and 4% of BioFAT into basic diets for post-weaning piglets for 3 weeks of feeding to improve growth performance and health status, 22.45% and 32.86% of daily gain which was a higher than controls. The study also showed that there is reduced feed consumption for kg of growth rate from 1.67 kg of control was down to 1.36; and 1.29 kg of feed consumption (FCR). Furthermore, BioFAT is also enhanced for piglets to resistance E.coli infection and rate of infections was lower in added 2 and 4% of BioFAT from 20% to 6.7 and 0% piglets diarrhea. Especially the practice has shown that diversity of Escherichia coli isolates were obtained from common host sources of fecal pollution and characterized by using repetitive extragenic palindromic (REP) PCR fingerprinting.

show abstract

“…The following primer sequences were used in targeting the 16S rRNA gene of bacteria: for E. coli , 5′‐CATGCCGCGTGTATGAAGAA‐3′ and 5′‐CGGGTAACGTCAATGAGCAAA‐3′, Probe: (6FAM)TATTAACTTTACTCCCTTCCTCCCCGCTGA(BHQ1); for Lactobacillus spp., 5′‐AGCAGTAGGGAATCT TCCA‐3′ and 5′‐CGCCACTGGTGTTCYTCCATATA‐3′; for Clostridium leptum subgroup, 5′‐GCACAAGCAGTGGAGT‐3′ and 5′‐CTTCCTCCGTTTTGTCAA‐3′; and for Clostridium coccoides , 5′‐CGGTACCTGACTAAGAAGC‐3′ and 5′‐AGTTTTATTCTTGCGAACG‐3′ (Fleury et al, ; Kong et al, ). Duplicate sample analyses were performed in mixtures (final volume, 10 μl) that contained 1 μl of diluted DNA sample and 0.2 μM of each primer, using a 1 × of SYBR ® Premix Ex Taq™ II Kit (TaKaRa Bio Inc., Shiga, Japan).…”

Section: Methodsmentioning

confidence: 99%

“…The following primer sequences were used in targeting the 16S rRNA gene of bacteria: for E. coli, 5′-CATGCCGCGTGTATGAAGAA-3′ and 5′-CGGGTAACGTCAATGAGCAAA-3′, Probe: (6FAM)TATTAAC TTTACTCCCTTCCTCCCCGCTGA(BHQ1); for Lactobacillus spp., 5′-AGCAGTAGGGAATCT TCCA-3′ and 5′-CGCCACTGGTGTTCYTCCA TATA-3′; for Clostridium leptum subgroup, 5′-GCACAAGCAGTGG AGT-3′ and 5′-CTTCCTCCGTTTTGTCAA-3′; and for Clostridium coccoides, 5′-CGGTACCTGACTAAGAAGC-3′ and 5′-AGTTTTATTCT TGCGAACG-3′ (Fleury et al, 2016;Kong et al, 2014)…”

Section: Bacterial Quantification By Real-time Pcrmentioning

confidence: 99%

The effects of dietary supplementation with porous zinc oxide on growth performance, intestinal microbiota, morphology, and permeability in weaned piglets

Peng

Chen

Yao

et al. 2019

Animal Science Journal

View full text Add to dashboard Cite

The objective of this experiment was to evaluate the effects of dietary supplementation with porous zinc oxide (HiZox) on growth performance, intestinal microbiota, morphology, and permeability in weaned piglets. A total of 128 weaned piglets [(Landrace × Yorkshire) × Duroc] with an average body weight (BW) of (6.55 ± 0.25 kg; 21 d of age) were randomly assigned to four dietary treatments: (1) a corn‐soybean basal diet; (2) basal diet + 3,000 mg/kg conventional ZnO; (3) basal diet + 200 mg/kg HiZox; (4) basal diet + 500 mg/kg HiZox. The experiments lasted for 28 days. Incremental HiZox in the diet increased ADG (linear p = 0.015; quadratic p = 0.043) and ADFI (linear p = 0.027; quadratic p = 0.038), and the diarrhea index decreased linearly and quadratically (p < 0.01) as HiZox supplemented increased. Furthermore, supplementation with HiZox increased the amounts of Lactobacillus spp. (p < 0.05) in the ileum and cecum in comparison with that of control treatment or 3,000 mg/kg ZnO treatment, while decreased the populations of Escherichia coli, Clostridium coccoides, and Clostridium. leptum subgroup (p < 0.05) in the ileum and cecum relative to those in control treatment. The addition of HiZox increased the villus height and villus‐to‐crypt ratio (VC) of duodenum, jejunum, and ileum (p < 0.05), while decreased the crypt depth of jejunum (p < 0.05) and tended to reduce the crypt depth of duodenum (p < 0.10) compared with the control treatment. Piglets fed with 500 mg/kg HiZox had lower serum D‐lactate and diamine oxidase (DAO) than those fed with basal control diet or 3,000 mg/kg ZnO diet (p < 0.01). The results suggested that supplementation with HiZox modulated intestinal microbial composition and improved intestinal morphology, which may exert protective effects on the integrity of the mucosal barrier function of weaned piglets, was as efficacious as pharmaceutical doses of ZnO in enhancing growth performance, indicating that the HiZox may be a promising alternative to pharmaceutical doses of ZnO.

show abstract

Impact of two different colistin dosing strategies on healthy piglet fecal microbiota

Cited by 20 publications

References 31 publications

Post weaning diarrhea in pigs: risk factors and non-colistin-based control strategies

Post weaning diarrhea in pigs: risk factors and non-colistin-based control strategies

Effect of Biofat on Growing Performance and Health Status of Post-Weaning Piglets

The effects of dietary supplementation with porous zinc oxide on growth performance, intestinal microbiota, morphology, and permeability in weaned piglets

Contact Info

Product

Resources

About