Impaired Neuronal Positioning and Dendritogenesis in the Neocortex after Cell-Autonomous Dab1 Suppression

Olson, Eric C.; Kim, Seonhee; Walsh, Christopher A.

doi:10.1523/jneurosci.3000-05.2006

Cited by 120 publications

(133 citation statements)

References 47 publications

Supporting

Mentioning

117

Contrasting

Order By: Relevance

“…Five days later, at E19.5, Dab1 shRNA neurons were significantly deeper than matched vector controls (P = 0.011) (Fig. 8A,B,D), as expected (Hammond et al 2001;Tabata and Nakajima 2002;Sanada et al 2004;Olson et al 2006). Dab1 shRNA neurons were also slightly deeper than controls at E17.5 (data not shown).…”

Section: Dab1 Role In Cul5-regulated Neuron Positioningsupporting

confidence: 69%

“…This is the "opposite" of the path followed by Dab1 shRNA neurons, which migrate at a slower rate than controls and settle below their normal position ( Fig. 8B; Olson et al 2006). As mentioned above, no other publication using shRNA to study neuronal migration has reported overmigration, so off-target effects are considered unlikely.…”

Section: Genes and Development 2725mentioning

confidence: 89%

“…In addition, in utero electroporation of Dab1 shRNA at E18 caused neurons to lag behind their siblings, and their leading processes were less developed (Olson et al 2006). In utero infection of wild-type or Dab1 mutant brains with retroviruses encoding phosphorylation site mutants of Dab1 allowed the role of Dab1 phosphorylation in the movement of individual neurons to be tested (Sanada et al 2004).…”

Section: Dab1 Role In Cul5-regulated Neuron Positioningmentioning

confidence: 99%

“…In all prior cases-JNK, Rac1, STEF/Tiam1, p27, LIS1, Ndel1, cytoplasmic dynein, doublecortin, doublecortin-like kinase, MDGA1, DYX1C1, KIAA0319, and Dab1 (Kawauchi et al 2003(Kawauchi et al , 2006Shu et al 2004;Tsai et al 2005;Koizumi et al 2006;Olson et al 2006;Paracchini et al 2006;Takeuchi and O'Leary 2006;Wang et al 2006)-inhibiting function inhibits migration and causes neurons to settle more deeply in or below the cortical plate. However, to our knowledge, the phenotype we observe in E14.5 neurons expressing Cul5 shRNA is unprecedented, …”

Section: Inhibiting Cul5 Function Causes a Novel Overmigration Of Neumentioning

confidence: 99%

“…We then introduced five silent mutations into the sequence targeted by Cul5 shRNA (GCTGCAGACAGAGCTCGTGG). Dab1 shRNA hairpin vectors A and B were built by inserting annealed oligos with the target sequences AATCACAGATTTGTGGCCATC (Olson et al 2006) and AGCCGCCTTCATGCCCACACA into the BglII and HindIII restriction sites in the pSuper_retro_puro vector.…”

Section: Neuron Cultures and Electroporationsmentioning

confidence: 99%

See 4 more Smart Citations

Cullin 5 regulates Dab1 protein levels and neuron positioning during cortical development

Li¹,

Allen²,

Simó³

et al. 2007

Genes Dev.

130

138

View full text Add to dashboard Cite

show abstract

Section: Dab1 Role In Cul5-regulated Neuron Positioningsupporting

confidence: 69%

Section: Genes and Development 2725mentioning

confidence: 89%

Section: Dab1 Role In Cul5-regulated Neuron Positioningmentioning

confidence: 99%

Section: Inhibiting Cul5 Function Causes a Novel Overmigration Of Neumentioning

confidence: 99%

Section: Neuron Cultures and Electroporationsmentioning

confidence: 99%

See 3 more Smart Citations

Cullin 5 regulates Dab1 protein levels and neuron positioning during cortical development

Li¹,

Allen²,

Simó³

et al. 2007

Genes Dev.

130

138

View full text Add to dashboard Cite

show abstract

Reelin receptors ApoER2 and VLDLR are expressed in distinct spatiotemporal patterns in developing mouse cerebral cortex

Hirota

Kubo

Katayama

et al. 2014

J of Comparative Neurology

View full text Add to dashboard Cite

In mammalian developing brain, neuronal migration is regulated by a variety of signaling cascades, including Reelin signaling. Reelin is a glycoprotein that is mainly secreted by Cajal-Retzius neurons in the marginal zone, playing essential roles in the formation of the layered neocortex via its receptors, apolipoprotein E receptor 2 (ApoER2) and very low density lipoprotein receptor (VLDLR). However, the precise mechanisms by which Reelin signaling controls the neuronal migration process remain unclear. To gain insight into how Reelin signaling controls individual migrating neurons, we generated monoclonal antibodies against ApoER2 and VLDLR and examined the localization of Reelin receptors in the developing mouse cerebral cortex. Immunohistochemical analyses revealed that VLDLR is localized to the distal portion of leading processes in the marginal zone (MZ), whereas ApoER2 is mainly localized to neuronal processes and the cell membranes of multipolar cells in the multipolar cell accumulation zone (MAZ). These different expression patterns may contribute to the distinct actions of Reelin on migrating neurons during both the early and late migratory stages in the developing cerebral cortex.

show abstract

Interfering of the Reelin/ApoER2/PSD95 Signaling Axis Reactivates Dendritogenesis of Mature Hippocampal Neurons

Ampuero

Jury

Härtel³

et al. 2016

Journal Cellular Physiology

View full text Add to dashboard Cite

Reelin, an extracellular glycoprotein secreted in embryonic and adult brain, participates in neuronal migration and neuronal plasticity. Extensive evidence shows that reelin via activation of the ApoER2 and VLDLR receptors promotes dendrite and spine formation during early development. Further evidence suggests that reelin signaling is needed to maintain a stable architecture in mature neurons, but, direct evidence is lacking. During activity-dependent maturation of the neuronal circuitry, the synaptic protein PSD95 is inserted into the postsynaptic membrane to induce structural refinement and stability of spines and dendrites. Given that ApoER2 interacts with PSD95, we tested if reelin signaling interference in adult neurons reactivates the dendritic architecture. Unlike findings in developing cultures, the presently obtained in vitro and in vivo data show, for the first time, that reelin signaling interference robustly increase dendritogenesis and reduce spine density in mature hippocampal neurons. In particular, the expression of a mutant ApoER2 form (ApoER2-tailless), which is unable to interact with PSD95 and hence cannot transduce reelin signaling, resulted in robust dendritogenesis in mature hippocampal neurons in vitro. These results indicate that reelin/ApoER2/PSD95 signaling is important for neuronal structure maintenance in mature neurons. Mechanistically, obtained immunofluorescent data indicate that reelin signaling impairment reduced synaptic PSD95 levels, consequently leading to synaptic re-insertion of NR2B-NMDARs. Our findings underscore the importance of reelin in maintaining adult network stability and reveal a new mode for reactivating dendritogenesis in neurological disorders where dendritic arbor complexity is limited, such as in depression, Alzheimer's disease, and stroke. J. Cell. Physiol. 232: 1187-1199, 2017. © 2016 Wiley Periodicals, Inc.

show abstract

Impaired Neuronal Positioning and Dendritogenesis in the Neocortex after Cell-Autonomous Dab1 Suppression

Cited by 120 publications

References 47 publications

Cullin 5 regulates Dab1 protein levels and neuron positioning during cortical development

Cullin 5 regulates Dab1 protein levels and neuron positioning during cortical development

Reelin receptors ApoER2 and VLDLR are expressed in distinct spatiotemporal patterns in developing mouse cerebral cortex

Interfering of the Reelin/ApoER2/PSD95 Signaling Axis Reactivates Dendritogenesis of Mature Hippocampal Neurons

Contact Info

Product

Resources

About