In silico discovery of small molecules for efficient stem cell differentiation into definitive endoderm

Novakovsky, Gherman; Sasaki, Shugo; Fornés, Oriol; Omur, Meltem E.; Huang, He; Bayly, Carmen; Zhang, Dahai; Lim, Nathaniel; Cherkasov, Artem; Pavlidis, Paul; Mostafavi, Sara; Lynn, Francis C.; Wasserman, Wyeth W.

doi:10.1016/j.stemcr.2023.01.008

Cited by 10 publications

(12 citation statements)

References 63 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…CD49a sorting entailed an indirect binding approach; CD49a epitopes were bound to CD49a-PE antibodies, which were subsequently bound to anti-PE microbeads for magnetic selection. We used an INS-GFP line that was previously characterized and collected cells for flow cytometry analysis at each stage of magnetic sorting (Novakovsky et al, 2023). Consistent with results reported by Veres et al, magnetically sorted SCβ-cell clusters showed approximately 50% more cells with INS-GFP and surface CD49 expression compared to unsorted stem cell derived islet clusters (Figure 3A&B).…”

Section: Macs Enriches For Cd49a On Scβ-cellssupporting

confidence: 82%

“…A gRNA sequence targeting the 3' end of the insulin coding sequence (GTGCAACTAGACGCAGCCCGC) was into the pCCC CRISPR/Cas9 vector as previously described to create pCCC-766/767 (Krentz et al, 2014;Novakovsky et al, 2023). For the donor vector we cloned 800bp homology arms into the KpnI/NheI and AscI/NotI sites of Addgene vector #31938 (Hockemeyer et al, 2011).…”

Section: Dna Targeting Constructsmentioning

confidence: 99%

See 1 more Smart Citation

Truncated CD19 as a selection marker for the isolation of stem cell derived β-cells

Huang

Zhang

Nian

et al. 2023

Preprint

Self Cite

View full text Add to dashboard Cite

Stem cell-derived β-cells (SCβ-cell) are a renewable and scalable alternative to cadaveric islets as a cell replacement therapy for type 1 diabetes (T1D). However, heterogeneity within SCβ-cell cultures remains problematic for graft safety and function. Magnetic selection of SCβ-cells expressing a unique cell surface marker may help deplete undesirable cell types and facilitate functional maturation. Here, we explored CD19 as a potential cell surface marker for the enrichment of insulin-expressing SCβ-cells. Using CRISPR/Cas9 technology, we created a knock-in add-on of CD19-mScarlet downstream of the insulin coding sequence in human embryonic stem cells (hESCs). We established reproducible SCβ-cell surface expression of CD19-mScarlet. Importantly, we developed and optimized a magnetic sorting protocol for CD19-mScarlet-expressing cells, forming enriched SCβ-cell clusters with improved glucose-stimulated c-peptide secretion. This strategy holds promise to facilitate large-scale production of functional SCβ-cells for disease modeling and cell replacement therapy.

show abstract

Section: Macs Enriches For Cd49a On Scβ-cellssupporting

confidence: 82%

Section: Dna Targeting Constructsmentioning

confidence: 99%

Truncated CD19 as a selection marker for the isolation of stem cell derived β-cells

Huang

Zhang

Nian

et al. 2023

Preprint

Self Cite

View full text Add to dashboard Cite

show abstract

“…The CRISPR/Cas9 system used to generate the INS EGFP GCG mScarlet hESC line was as previously described (Huang et al, 2023;Krentz et al, 2014;Novakovsky et al, 2023). The pCCC CRISPR/Cas9 plasmids were generated to express gRNA (5'-TGCAACTAGACGCAG-3') and (5'-AACATCACCTGCTAGCCACG-3') for targeting the 3' end of the endogenous insulin (INS) and glucagon (GCG) coding regions respectively.…”

Section: Crispr/cas9 Knock-inmentioning

confidence: 99%

“…We generated a reporter hESC line using CRISPR/Cas9-mediated knock-in to identify and isolate insulin-and glucagon-expressing cells in hESC-derived pancreatic endocrine cell cultures. We first developed the single knock-in INS EGFP hESC line by inserting a 2A-EGFP expression cassette into exon 3 of the endogenous INS gene in the H1 hESC line (Figure 1A) (Novakovsky et al, 2023). We specifically replaced the stop codon of the INS gene to prevent disruptions to insulin processing in INS-expressing cells (Blöchinger et al, 2020).…”

Section: Generation Of the Ins Egfp Gcg Mscarlet Hesc Reporter Line U...mentioning

confidence: 99%

“…Therefore, human embryonic stem cells (hESCs) have been proposed to serve as an unlimited and reliable source of pancreatic beta and alpha cells for the treatment of diabetes (Shapiro & Verhoeff, 2023). hESC lines engineered to report insulin using a fluorescent protein have proved to be an efficient tool used to further improve the generation of pancreatic beta cells in vitro Nair et al, 2019;Novakovsky et al, 2023). These fluorescence protein-expressing cells can easily be visualized using a benchtop fluorescence microscope, used in high throughput screens or isolated using fluorescence activated cell sorting (FACS) for downstream analyses (Giudice & Trounson, 2008).…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Tracking insulin- and glucagon-expressing bihormonal cells during differentiation using anINSULINandGLUCAGONdouble reporter human embryonic stem cell line

Mar

Filatov

Nian

et al. 2023

Preprint

Self Cite

View full text Add to dashboard Cite

Human embryonic stem cell (hESC)-derived pancreatic alpha and beta cells can be used to develop cell replacement therapies to treat diabetes. However, recent published differentiation protocols yield varying amounts of alpha and beta cells amidst heterogeneous cell populations. To visualize and isolate hESC-derived alpha and beta cells, we generated a GLUCAGON-2A-mScarlet and INSULIN-2A-EGFP dual fluorescent reporter (INSEGFPGCGmScarlet) hESC line using CRISPR/Cas9. We established robust expression of EGFP and mScarlet fluorescent proteins in insulin- and glucagon-expressing cells respectively without compromising the differentiation or function of these cells. We also showed the insulin- and glucagon-expressing bihormonal population at the maturing endocrine cell stage (Stage 6) lose insulin expression over time, while maintaining an alpha-like expression profile, suggesting these bihormonal cells are preferentially fated to become alpha-like cells in vitro. Together, the INSEGFPGCGmScarlet hESC line provides an efficient strategy for tracking populations of hESC-derived beta- and alpha-like cells.

show abstract

Proteomic predictors of individualized nutrient-specific insulin secretion in health and disease

Kolic,

Sun,

Cen

et al. 2024

Cell Metabolism

Self Cite

View full text Add to dashboard Cite

In silico discovery of small molecules for efficient stem cell differentiation into definitive endoderm

Cited by 10 publications

References 63 publications

Truncated CD19 as a selection marker for the isolation of stem cell derived β-cells

Truncated CD19 as a selection marker for the isolation of stem cell derived β-cells

Tracking insulin- and glucagon-expressing bihormonal cells during differentiation using anINSULINandGLUCAGONdouble reporter human embryonic stem cell line

Proteomic predictors of individualized nutrient-specific insulin secretion in health and disease

Contact Info

Product

Resources

About