In the African Lungfish Met-Enkephalin and Leu-Enkephalin Are Derived from Separate Genes: Cloning of a Proenkephalin cDNA

Abstract

A full-length proenkephalin cDNA (accession number: AF232670) was cloned from an African lungfish (Protopterus annectens) brain cDNA library. The 1,351-bp African lungfish proenkephalin contains an open reading frame that codes 266 amino acids and a stop codon. Within the sequence of lungfish proenkephalin there are 5 pentapeptide opioid sequences (all YGGFM), 1 octapeptide opioid sequence (YGGFMRSL) and 1 heptapeptide opioid sequence (YGGFMGY). A Leu-enkephalin sequence was conspicuously absent in lungfish proenkephalin. These results, coupled with observations on the organization of amphibian proenkephalin and mammalian proenkephalin, indicate that among the Sarcopterygii (lobed finned fish and tetrapods), the appearance of a Leu-enkephalin sequence in proenkephalin may have evolved in either the ancestral amniotes or the ancestral mammals, but not earlier in sarcopterygian evolution. Furthermore, the detection of neurons in the lungfish CNS that are only immunopositive for Met-enkephalin, coupled with earlier anatomical studies on the presence of neurons in the lungfish CNS that are only immunopositive for Leu-enkephalin, indicates that a Leu-enkephalin-coding opioid gene must be present in the CNS of the lungfish. This gene may be the lungfish form of prodynorphin. Given the phylogenetic position of the lungfish in vertebrate evolution, the putative Leu-enkephalin-coding gene must have evolved in the ancestral sarcopterygian vertebrates, or in the ancestral gnathostomes. The apparent slow rate of lungfish evolution makes these organisms interesting models for investigating the evolution of the opioid/orphanin gene family.

Analyzing the evolution of the opioid/orphanin gene family

“…However, this third predicted pentapeptide opioid site may have been retained in species of fish like the sturgeon or the lungfish. Studies on the POMC gene and the proenkephalin gene in these species suggest that the opioid genes may be evolving at a slower rate than in other gnathostome groups Lee et al, 1999a;Dores et al, 2000;Sollars et al, 2000).…”

An indirect basal ganglia pathway in anuran amphibians?

“…There is no crossreactivity to beta-endorphin or dynorphin. The amino acid sequences of Met5-and Leu5-enkephalin are the same throughout vertebrate groups (Dores et al, 2000;Salzet, 2001), so reactivity of this antibody with rat enkephalin (Freeman et al, 2003) predicts reactivity in the frog as well, but has not been confirmed so far.…”

Cloning of Prodynorphin cDNAs from the Brain of Australian and African Lungfish: Implications for the Evolution of the Prodynorphin Gene

“…The detection of distinct Met- and Leu-enkephalin-immunoreactive neurons in the CNS of the African lungfish [15]could have been the result of differential posttranslational processing of the proenkephalin gene if lungfish proenkephalin had the same organizational plan as mammalian proenkephalin. This is not the case [12, 13], hence the Met-enkephalin-positive neurons must be expressing the proenkephalin gene, and the Leu-enkephalin-positive neurons must be expressing the prodynorphin gene. The steady-state analyses of Met-enkephalin and Leu-enkephalin that were done for the Australian lungfish [14]provide an approximation of the relative expression levels for the proenkephalin and prodynorphin genes in this species.…”

“…For the initial 3′RACE reaction, a degenerate opioid-specific forward primer (POMC 1024: 5′′AA[A/G][A/G]GITA[C/T]GGIGGITT[C/T]ATG3′ [13]) was used with a reverse primer (anchor: 5′GACTCGAGTCGGATCCATCGAT3′), targeted to the 5′′ terminus of the anchor dT 17 primer that was incorporated into all cDNAs during first-strand synthesis. The brackets indicate mixed bases and the ‘I’ represents deoxyinosines which were used to minimize helix instability due to potential base pair mismatches at sites of fourfold degeneracy [18].…”

“…Support for the latter conclusion comes from the cloning of proenkephalin cDNAs from the CNS of the Australian lungfish [12]and the African lungfish [13]. These lobe-finned fish proenkephalin cDNAs encode five Met-enkephalin sequences, an 8-amino-acid extended form of Met-enkephalin (YGGFMRSL), and a 7-amino-acid extended form of Met-enkephalin (YGGFMGY).…”