In Vitro Effect of DFC-2 on Mycolic Acid Biosynthesis in Mycobacterium tuberculosis

Kim, Sukyung; Seo, Hoonhee; Mahmud, Hafij Al; Islam, Imtiazul; Kim, Yong-Sik; Lyu, Jiwon; Nam, Kwanghee; Lee, Byung-Eui; Lee, Kee‐In; Song, Ho‐Yeon

doi:10.4014/jmb.1705.05013

Cited by 8 publications

(5 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…As reported earlier [ 131 , 132 ], the anti-TB drug isoniazid causes the destruction of the H37Rv cell wall by inhibiting the synthesis of mycolic acids. However, the morphology of H37Rv cells treated with isoniazid is significantly different from H37Rv cells treated with 5-substituted pyrimidine nucleosides.…”

Section: Potential Targets Of the Antimicrobial Action For 5-modified...mentioning

confidence: 61%

Analogues of Pyrimidine Nucleosides as Mycobacteria Growth Inhibitors

et al. 2022

View full text Add to dashboard Cite

Tuberculosis (TB) is the oldest human infection disease. Mortality from TB significantly decreased in the 20th century, because of vaccination and the widespread use of antibiotics. However, about a third of the world’s population is currently infected with Mycobacterium tuberculosis (Mtb) and the death rate from TB is about 1.4–2 million people per year. In the second half of the 20th century, new extensively multidrug-resistant strains of Mtb were identified, which are steadily increasing among TB patients. Therefore, there is an urgent need to develop new anti-TB drugs, which remains one of the priorities of pharmacology and medicinal chemistry. The antimycobacterial activity of nucleoside derivatives and analogues was revealed not so long ago, and a lot of studies on their antibacterial properties have been published. Despite the fact that there are no clinically used drugs based on nucleoside analogues, some progress has been made in this area. This review summarizes current research in the field of the design and study of inhibitors of mycobacteria, primarily Mtb.

show abstract

Section: Potential Targets Of the Antimicrobial Action For 5-modified...mentioning

confidence: 61%

Analogues of Pyrimidine Nucleosides as Mycobacteria Growth Inhibitors

et al. 2022

View full text Add to dashboard Cite

show abstract

“…As previously reported, real-time PCR experiments for M. tuberculosis were performed [ 25 ]. The Rv0560c gene targeting primers used in this study were as follows: sense primer sequence (5′-3′), GTAGAACTGGCTCGGCATGA; antisense primer (5′-3′), CCGGTCGAATACCAACACGA.…”

Section: Methodsmentioning

confidence: 99%

Increased Susceptibility of Mycobacterium tuberculosis to Ethionamide by Expressing PPs-Induced Rv0560c

et al. 2022

View full text Add to dashboard Cite

Tuberculosis, an infectious disease, is one of the leading causes of death worldwide. Drug-resistant tuberculosis exacerbates its threat. Despite long-term and costly treatment with second-line drugs, treatment failure rates and mortality remain high. Therefore, new strategies for developing new drugs and improving the efficiency of existing drug treatments are urgently needed. Our research team reported that PPs, a new class of potential anti-tuberculosis drug candidates, can inhibit the growth of drug-resistant Mycobacterium tuberculosis. Here, we report a synergistic effect of PPs with ethionamide (ETH), one of the second-line drugs, as a result of further research on PPs. While investigating gene expression changes based on microarray and 2DE (two-dimensional gel electrophoresis), it was found that PPs induced the greatest overexpression of Rv0560c in M. tuberculosis. Based on this result, a protein microarray using Rv0560c protein was performed, and it was confirmed that Rv0560c had the highest interaction with EthR, a repressor for EthA involved in activating ETH. Accordingly, a synergistic experiment was conducted under the hypothesis of increased susceptibility of ETH to M. tuberculosis by PPs. As a result, in the presence of 0.5× MIC PPs, ETH showed a growth inhibitory effect on drug-sensitive and -resistant M. tuberculosis even at a much lower concentration of about 10-fold than the original MIC of ETH. It is also suggested that the effect was due to the interaction between PPs and Rv2887, the repressor of Rv0560c. This effect was also confirmed in a mouse model of pulmonary tuberculosis, confirming the potential of PPs as a booster to enhance the susceptibility of M. tuberculosis to ETH in treating drug-resistant tuberculosis. However, more in-depth mechanistic studies and extensive animal and clinical trials are needed in the future.

show abstract

“…M. tuberculosis H37Rv (ATCC 27294) was purchased from the American Type Culture Collection (ATCC, USA), and XDR M. tuberculosis (KMRC 00203-00197) was obtained from the Korean Mycobacterium Resource Center (KMRC, Korea). Based on the microdilution technique, the concentrations of isoniazid (INH), rifampicin (RIF), streptomycin (STR), pyrazinamide (PZA), and ethambutol (EMB) were 0.19, 0.09, 0.19, >200, and 0.78 μg/ml for M. tuberculosis H37Rv, respectively, and 25, 100, 1.56, >200, and 6.25 μg/ml for XDR M. tuberculosis , respectively [ 24 ]. M. tuberculosis was cultured at 37°C in Middlebrook 7H9 broth (BD Difco) supplemented with 10% OADC (oleic acid-albumin-dextrose-catalase) (BD Difco) and 0.5% Tween 80 (Sigma-Aldrich, USA).…”

Section: Methodsmentioning

confidence: 99%

Anti-Tuberculosis Activity of Pediococcus acidilactici Isolated from Young Radish Kimchi against Mycobacterium tuberculosis

Yoon

Seo

Kim

et al. 2021

J. Microbiol. Biotechnol.

Self Cite

View full text Add to dashboard Cite

Tuberculosis is a highly contagious disease caused by Mycobacterium tuberculosis. It affects about 10 million people each year and is still one of the leading causes of death worldwide. About 2 to 3 billion people (equivalent to 1 in 3 people in the world) are infected with latent tuberculosis. Moreover, as the number of multidrug-resistant, extensively drug-resistant, and totally drug-resistant strains of M. tuberculosis continues to increase, there is an urgent need to develop new anti-tuberculosis drugs that are different from existing drugs to combat antibiotic-resistant M. tuberculosis. Against this background, we aimed to develop new anti-tuberculosis drugs using probiotics. Here, we report the anti-tuberculosis effect of Pediococcus acidilactici PMC202 isolated from young radish kimchi, a traditional Korean fermented food. Under coculture conditions, PMC202 inhibited the growth of M. tuberculosis. In addition, PMC202 inhibited the growth of drug-sensitive and -resistant M. tuberculosisinfected macrophages at a concentration that did not show cytotoxicity and showed a synergistic effect with isoniazid. In a 2-week, repeated oral administration toxicity study using mice, PMC202 did not cause weight change or specific clinical symptoms. Furthermore, the results of 16S rRNA-based metagenomics analysis confirmed that dysbiosis was not induced in bronchoalveolar lavage fluid after oral administration of PMC202. The anti-tuberculosis effect of PMC202 was found to be related to the reduction of nitric oxide. Our findings indicate that PMC202 could be used as an anti-tuberculosis drug candidate with the potential to replace current chemicalbased drugs. However, more extensive toxicity, mechanism of action, and animal efficacy studies with clinical trials are needed.

show abstract

In Vitro Effect of DFC-2 on Mycolic Acid Biosynthesis in Mycobacterium tuberculosis

Cited by 8 publications

References 31 publications

Analogues of Pyrimidine Nucleosides as Mycobacteria Growth Inhibitors

Analogues of Pyrimidine Nucleosides as Mycobacteria Growth Inhibitors

Increased Susceptibility of Mycobacterium tuberculosis to Ethionamide by Expressing PPs-Induced Rv0560c

Anti-Tuberculosis Activity of Pediococcus acidilactici Isolated from Young Radish Kimchi against Mycobacterium tuberculosis

Contact Info

Product

Resources

About