In vivo and in vitro analysis of transcriptional activation mediated by the human cytomegalovirus major immediate-early proteins.

Abstract

To define mechanistically how the human cytomegalovirus (HCMV) major immediate-early (IE) Human cytomegalovirus (HCMV), a member of the herpesvirus family, is an important pathogen implicated in a variety of diseases in newborn and immunocompromised individuals (for reviews, see references 2 and 59). Like other members of the herpesvirus family, the genome of HCMV is temporally expressed during the viral life cycle (16, 56,81,88,89 (16,17,29,33,34, 56,64,79,80,82,88,89,91). At least three IE RNAs have been found to be transcribed from these regions (Fig. 1B) (62,66,77,80).In previous studies, we and others have used transientexpression assays to demonstrate that HCMV early promoters as well as heterologous viral and cellular promoters can be activated by the region of the genome specifying the IE1 and IE2 gene products (4,5,9,12,15,18,20,23,26,29,39,53,60,63,67,75,85,87). Recent studies suggest that the IE2 86-kDa protein plays a major role in activating HCMV early promoters as well as in repressing its own promoter (the major IE promoter), while the IE1 72-kDa protein acts to enhance the activity of the major IE promoter and may augment the stimulatory effect of the IE2 86-kDa protein (10-12, 26, 28, 50, 53, 61-63, 69, 78).Any consideration of the mechanism by which the HCMV IE1 and IE2 proteins affect transcription must take into account the fact that multiple viral and cellular promoters 1238 on April 27, 2019 by guest

Two Gamma Interferon-Activated Site-Like Elements in the Human Cytomegalovirus Major Immediate-Early Promoter/Enhancer Are Important for Viral Replication

“…Transient-transfection assays showed that the IE1 and IE2 proteins are potent transcription factors that cooperatively activate transcription from many promoters, including HCMV early promoters (9,21,23). However, these transient-transfection assays do not reflect the actual infection situation.…”

Distinct Roles for Human Cytomegalovirus Immediate Early Proteins IE1 and IE2 in the Transcriptional Regulation of MICA and PVR/CD155 Expression

“…pGL2-PVR (2571 bp fragment) promoter luciferase reporter vector and progressive deletions were provided by Dr. G. Bernhardt (Hannover Medical School, Hannover, Germany) (60). pSG5-IE1, pSG5-IE2, and pSG5-IE55 were previously described (24). The IE2 cDNA cloned in the pRSV vector and the zinc finger mutant of IE2, with cysteines 428 and 434 mutated into serine residues (pRSV-IE2-Zn mut), were a gift of Prof. Jay Nelson (61).…”

“…These IE2 activities are crucial for transcriptional activation of viral and host genes, as well as for regulation of several cellular functions (19). The IE55 protein is a splice variant of IE2 gene product, with a deletion between residues 365 and 519 in the C terminus, a region required for many IE2 functions, including transcriptional activation and DNA binding (19,(21)(22)(23)(24)(25).…”

Inhibition of IL-1β transcription by peptides derived from the hCMV IE2 transactivator

“…Spi1 cDNA was also PCR amplified and inserted into pGEX2T (Amersham) for use in GST pull down assays (Wara-aswapati et al, 1999). Also for GST pull down assays, hCMV IE1 and IE2 cDNA was previously constructed within pGEX 3X (Klucher et al, 1993). IE2 291-364delA pGEX 2T was PCR amplified using four primers: an internal pair to create a 14 aa deletion 5'ctgcggccatcagagcagcatctccgagttggacaacg3' and 5'cgttgtccaactcggagatgctgctctgatggccgcag3', and external primers: 5'ctcctcggatccagccaccatgggcgcggcgg3', and 5'ctcgaattcctcgtcaatcttgacgcgaccccg3'.…”