In vivo knockdown of antisense non‐coding mitochondrial <scp>RNA</scp>s by a lentiviral‐encoded sh<scp>RNA</scp> inhibits melanoma tumor growth and lung colonization

Varas-Godoy, Manuel; Lladser, Álvaro; Farfán, Nicole; Villota, Claudio; Villegas, Jaime; Tapia, Julio C.; Burzio, Luis O.; Burzio, Verónica A.; Valenzuela, Pablo

doi:10.1111/pcmr.12615

Cited by 33 publications

(30 citation statements)

References 38 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Transduction with lentiviral constructs targeted to the ASncmtRNAs induced apoptosis in murine B16F10 and human A375 melanoma cells in vitro and significantly retarded B16F10 primary tumor growth in vivo. ASK treatment drastically reduced the number of lung metastatic foci in a tail vein injection assay, compared to controls [55]. These results provide additional proof-of-concept for knockdown of ncmtRNAs for cancer therapy and altogether, our results suggest that ASncmtRNAs could be potent targets for melanoma therapy.…”

Section: Targeting Antisense Noncoding Mitochondrial Rna: From Bench supporting

confidence: 59%

Long Noncoding Mitochondrial RNAs (LncmtRNAs) as Targets for Cancer Therapy

Villegas¹,

Burzio²,

Borgna³

et al. 2018

Mitochondrial DNA - New Insights

Self Cite

View full text Add to dashboard Cite

Mitochondria are traditionally been viewed as the cell's powerhouse, generating most of its ATP. However, besides this fundamental metabolic role, mitochondria are implicated in diverse other processes, including apoptosis, inflammation and metastasis. These functions are exerted in part by the growing class of long noncoding mitochondrial RNAs (lncmtRNAs). We found that normal human proliferating cells express a family of noncoding mitochondrial RNAs (ncmtRNAs), comprised of sense (SncmtRNA) and antisense (ASncmtRNA). However, tumor cells express only sense transcripts, suggesting that ASncmtRNA downregulation as a cancer new hallmark. The few ASncmtRNAs copies in tumor cells seem essential to tumor cell viability: knockdown of these transcripts with antisense oligonucleotides (ASO) causes massive apoptotic death of tumor cells, preceded by cell cycle arrest. Preclinical assays show that systemic administration of ASO delayed tumor growth in melanoma and renal cancer models and, caused total remission in subcutaneous renal cancer tumors. The same treatment, however, does not affect normal tissue, suggesting this approach for the development of an efficient and safe therapeutic strategy for several cancer types.

show abstract

Section: Targeting Antisense Noncoding Mitochondrial Rna: From Bench supporting

confidence: 59%

Long Noncoding Mitochondrial RNAs (LncmtRNAs) as Targets for Cancer Therapy

Villegas¹,

Burzio²,

Borgna³

et al. 2018

Mitochondrial DNA - New Insights

Self Cite

View full text Add to dashboard Cite

show abstract

“…Oligos used to construct the shRNA targeting mouse Wnt5a were: 5′‐TG GTGCTGCTATGTCAAATGCAAGATTCAAGAGATCTTGCATTTGACATAGCAGCACCTTTTTTC‐3′ (forward); 5′‐TCGAGAAAAAAGGTGCTGCTATGTCAAATGCAAGATCTCTTGAATCTTGCATTTGACATAGCAGCAC‐3′ (reverse). Oligos used to generate the control shRNA were: 5′‐TGTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAACTTTTTTC‐3′ (forward); 5′‐TCGAGAAAAAAGTTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAACA‐3′ (reverse) . LV particles were prepared as previously described with some modifications.…”

Section: Methodsmentioning

confidence: 99%

“…Oligos used to generate the control shRNA were: 5 0 -TGTTCTCCGAACGTGTCACGTTTCAAGAGAACGTG ACACGTTCGGAGAACTTTTTTC-3 0 (forward); 5 0 -TCGAGAAAAAAGTTC TCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAACA-3 0 (reverse). 46 LV particles were prepared as previously described 47 Santa Clara, CA). Primers used were: Wnt5a: 5 0 -GGTGCCATGTCTTCC AAGTT-3 0 (forward) and 5 0 -GAGAGGCTGTGCACCTATGA-3 0 (reverse); GAPDH: 5 0 -CATGGCCTTCCGTGTTCCTA-3 0 (forward) and 5 0 -CCTGCTT CACCACCTTCTTGAT-3 0 (reverse).…”

Section: Significance Statementmentioning

confidence: 99%

Wnt5a promotes differentiation and development of adult-born neurons in the hippocampus by noncanonical Wnt signaling

et al. 2019

Self Cite

View full text Add to dashboard Cite

In the adult hippocampus, new neurons are generated in the dentate gyrus. The Wnt signaling pathway regulates this process, but little is known about the endogenous Wnt ligands involved. We investigated the role of Wnt5a on adult hippocampal neurogenesis. Wnt5a regulates neuronal morphogenesis during embryonic development, and maintains dendritic architecture of pyramidal neurons in the adult hippocampus. Here, we determined that Wnt5a knockdown in the mouse dentate gyrus by lentivirus‐mediated shRNA impaired neuronal differentiation of progenitor cells, and reduced dendritic development of adult‐born neurons. In cultured adult hippocampal progenitors (AHPs), Wnt5a knockdown reduced neuronal differentiation and morphological development of AHP‐derived neurons, whereas treatment with Wnt5a had the opposite effect. Interestingly, no changes in astrocytic differentiation were observed in vivo or in vitro, suggesting that Wnt5a does not affect fate‐commitment. By using specific inhibitors, we determined that Wnt5a signals through CaMKII to induce neurogenesis, and promotes dendritic development of newborn neurons through activating Wnt/JNK and Wnt/CaMKII signaling. Our results indicate Wnt5a as a niche factor in the adult hippocampus that promotes neuronal differentiation and development through activation of noncanonical Wnt signaling pathways.

show abstract

“…5B,C). These in vivo results strongly suggest that exosomes released from control cells contain factors that enhance tumorigenic properties, while exosomes secreted upon ASncmtRNA knockdown harbor factors that promote the opposite outcome, similar to the effects brought upon directly by transfection of a myriad of tumor cell types with ASO-1537S 34,37,39 .…”

Section: Discussionmentioning

confidence: 66%

“…ASncmtRNA knockdown causes significant cell death in a wide array of cancer cell lines [35][36][37]41 . The percentage of cell death varies among cell lines 35 and, as our results show, this percentage is around 16-40% in several breast cancer cells at 24 h (Fig.…”

Section: Discussionmentioning

confidence: 99%

Exosomes released upon mitochondrial ASncmtRNA knockdown reduce tumorigenic properties of malignant breast cancer cells

Lobos-González

Bustos

Campos

et al. 2020

Sci Rep

Self Cite

View full text Add to dashboard Cite

During intercellular communication, cells release extracellular vesicles such as exosomes, which contain proteins, ncRNAs and mRNAs that can influence proliferation and/or trigger apoptosis in recipient cells, and have been proposed to play an essential role in promoting invasion of tumor cells and in the preparation of metastatic niches. Our group proposed the antisense non-coding mitochondrial RNA (ASncmtRNA) as a new target for cancer therapy. ASncmtRNA knockdown using an antisense oligonucleotide (ASO-1537S) causes massive death of tumor cells but not normal cells and strongly reduces metastasis in mice. In this work, we report that exosomes derived from ASO-1537S-treated MDA-MB-231 breast cancer cells (Exo-1537S) inhibits tumorigenesis of recipient cells, in contrast to exosomes derived from control-ASO-treated cells (Exo-C) which, in contrast, enhance these properties. Furthermore, an in vivo murine peritoneal carcinomatosis model showed that Exo-1537S injection reduced tumorigenicity compared to controls. Proteomic analysis revealed the presence of Lactadherin and VE-Cadherin in exosomes derived from untreated cells (Exo-WT) and Exo-C but not in Exo-1537S, and the latter displayed enrichment of proteasomal subunits. These results suggest a role for these proteins in modulation of tumorigenic properties of exosome-recipient cells. Our results shed light on the mechanisms through which ASncmtRNA knockdown affects the preparation of breast cancer metastatic niches in a peritoneal carcinomatosis model.Breast cancer is one of the most common cancers in women worldwide, as one in every eight females will be diagnosed with this disease in their lifetime 1 . Current treatments for this type of cancer are mastectomy, chemotherapy, radiation and hormone therapy, among others; but the downside of these treatments is that the rate of success is very low in advanced stages of the disease 2-4 , mainly because secondary niches in breast cancer are multi-tissue and, in consequence, the location of the residuary is unpredictable 5-7 . This second niche can localize to lymph

show abstract

In vivo knockdown of antisense non‐coding mitochondrial RNAs by a lentiviral‐encoded shRNA inhibits melanoma tumor growth and lung colonization

Cited by 33 publications

References 38 publications

Long Noncoding Mitochondrial RNAs (LncmtRNAs) as Targets for Cancer Therapy

Long Noncoding Mitochondrial RNAs (LncmtRNAs) as Targets for Cancer Therapy

Wnt5a promotes differentiation and development of adult-born neurons in the hippocampus by noncanonical Wnt signaling

Exosomes released upon mitochondrial ASncmtRNA knockdown reduce tumorigenic properties of malignant breast cancer cells

Contact Info

Product

Resources

About