Increased Anoxic Resistance Resulting from Short Period Heat Adaptation

Hiestand, Wm. A.; Stemler, Fred W.; Jasper, R. L.

doi:10.3181/00379727-88-21501

Cited by 9 publications

(3 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“… 9 This phenomenon, described as “cross-tolerance,” involves the activation of common protective pathways, 10 and has been studied predominantly in small mammals. Hiestand et al., 11 studied mice heat acclimated (HA) to 36–37°C for 10-14 d and found they tolerated a hypoxic environment better than unacclimated mice. Cross-tolerance between cold and hypoxia has also been examined in rats.…”

Section: Introductionmentioning

confidence: 99%

The effect of 10 days of heat acclimation on exercise performance in acute hypobaric hypoxia (4350 m)

et al. 2015

View full text Add to dashboard Cite

To examine the effect (“cross-tolerance”) of heat acclimation (HA) on exercise performance upon exposure to acute hypobaric hypoxia (4350 m). Eight male cyclists residing at 1600 m performed tests of maximal aerobic capacity (VO2max) at 1600 m and 4350 m, a 16 km time-trial at 4350 m, and a heat tolerance test at 1600 m before and after 10 d HA at 40°C, 20% RH. Resting blood samples were obtained pre-and post- HA to estimate changes in plasma volume (ΔPV). Successful HA was indicated by significantly lower exercise heart rate and rectal temperature on day 10 vs. day 1 of HA and during the heat tolerance tests. Heat acclimation caused a 1.9% ΔPV, however VO2max was not significantly different at 1600 m or 4350 m. Time-trial cycling performance improved 28 sec after HA (p = 0.07), suggesting a possible benefit for exercise performance at acute altitude and that cross-tolerance between these variables may exist in humans. These findings do not clearly support the use of HA to improve exercise capacity and performance upon acute hypobaric hypoxia, however they do indicate that HA is not detrimental to either exercise capacity or performance.

show abstract

Section: Introductionmentioning

confidence: 99%

The effect of 10 days of heat acclimation on exercise performance in acute hypobaric hypoxia (4350 m)

et al. 2015

View full text Add to dashboard Cite

show abstract

“…Sense and antisence sequences, respectively were: NR1: GGCACAGGCAGTTCACGAACTCC; TAGATGCCCACTTGCACCAGCTTG; NR2A:CCTCCCGGAGCATAAGCCTCAAGG; GTGTTTGTAAGGGTCCGAGGGAC NR2B:AGCTCCATTGATGGGCTCTATGACTG; GTTGCCCTCGATGTTCCCATAGGTG. β actin was used as a housekeeping gene as our protocols do not change its levels 43 , 52 . β ACTIN - sense: GAGACCTTCAACAACCCAGCC, antisense: GGCCATCTCTTGCTCGAAGTC.…”

Section: Methodsmentioning

confidence: 99%

The protective effect of heat acclimation from hypoxic damage in the brain involves changes in the expression of glutamate receptors

2014

View full text Add to dashboard Cite

Long-term heat acclimation (34 °C, 30d) alters the physiological responses and the metabolic state of organisms. It also improves ability to cope with hypoxic stress via a cross-tolerance mechanism. Within the brain, the hippocampal and frontal cortex neurons are the most sensitive to hypoxia and cell death is mainly caused by calcium influx via glutamate-gated ion channels, specifically NMDA and AMPA receptors. GluN1 subunit levels of NMDA-R correspond to NMDA-R levels. GluN2B/GluN2A subunit ratio is a qualitative index of channel activity; a higher ratio implies lower calcium permeability. The GluA2 subunit of AMPA-R controls channel permeability by inhibiting calcium penetration. Here, in rats model we (i)used behavioral-assessment tests to evaluate heat acclimation mediated hypoxic (15’ 4.5 ± 0.5% O2) neuroprotection, (ii) measured protein and transcript levels of NMDA-R and AMPA-R subunits before and after hypoxia in the hippocampus and the frontal cortex, to evaluate the role of Ca2+ in neuro-protection/cross-tolerance. Behavioral tests confirmed hypoxic tolerance in long-term (30d) but not in short-term (2d) heat acclimated rats. Hypoxic tolerance in the long-term acclimated phenotype was accompanied by a significant decrease in basal NMDA receptor GluN1 protein and an increase in its mRNA. The long-term acclimated rats also showed post ischemic increases in the GluN2B/GluN2A subunit ratio and GluA2 subunit of the AMPA receptor, supporting the hypothesis that reduced calcium permeability contributes to heat acclimation mediated hypoxia cross-tolerance. Abrupt post ischemic change in GluN2B/GluN2A subunit ratio with no change in NMDA-R subunits transcript levels implies that post-translational processes are inseparable acclimatory cross-tolerance mechanism.

show abstract

“…Evidence suggests that prior heat exposure may be advantageous to those exercising in hypoxia. Hiestand and colleagues [86] reported that, when mice were continuously exposed to heat for 10 to 14 d, the animals had an increased tolerance to anoxia compared to those not exposed to heat (42.1 ± 3.5, 48.2 ± 5.9, and 54.3 ± 4.2 sec, resp., for no heat, 10 d and 14 d of heat exposure). In humans, Heled and colleagues [87] reported that, after 12 d of HA (40 ∘ C temperature and 40% relative humidity) at sea-level, SaO 2 during walking exercise (7 km/h) at an FIO 2 of 15.6% (simulated altitude of 2430 m) was significantly improved (86.5 ± 2% versus 88 ± 2% from preheat acclimation to postheat acclimation, resp.).…”

Section: Interaction Between Hsp90 and Hif1mentioning

confidence: 99%

A Novel Mechanism for Cross-Adaptation between Heat and Altitude Acclimation: The Role of Heat Shock Protein 90

et al. 2014

View full text Add to dashboard Cite

Heat shock protein 90 (HSP90) is a member of a family of molecular chaperone proteins which can be upregulated by various stressors including heat stress leading to increases in HSP90 protein expression. Its primary functions include (1) renaturing and denaturing of damaged proteins caused by heat stress and (2) interacting with client proteins to induce cell signaling for gene expression. The latter function is of interest because, in cancer cells, HSP90 has been reported to interact with the transcription hypoxic-inducible factor 1α(HIF1α). In a normoxic environment, HIF1αis degraded and therefore has limited physiological function. In contrast, in a hypoxic environment, stabilized HIF1αacts to promote erythropoiesis and angiogenesis. Since HSP90 interacts with HIF1α, and HSP90 can be upregulated from heat acclimation in humans, we present a proposal that heat acclimation can mimic molecular adaptations to those of altitude exposure. Specifically, we propose that heat acclimation increases HSP90 which then stabilizes HIF1αin a normoxic environment. This has many implications since HIF1αregulates red blood cell and vasculature formation. In this paper we will discuss (1) the functional roles of HSP90 and HIF1α, (2) the interaction between HSP90 and other client proteins including HIF1α, and (3) results fromin vitrostudies that may suggest how the relationship between HSP90 and HIF1αmight be applied to individuals preparing to make altitude sojourns.

show abstract

Increased Anoxic Resistance Resulting from Short Period Heat Adaptation

Cited by 9 publications

References 0 publications

The effect of 10 days of heat acclimation on exercise performance in acute hypobaric hypoxia (4350 m)

The effect of 10 days of heat acclimation on exercise performance in acute hypobaric hypoxia (4350 m)

The protective effect of heat acclimation from hypoxic damage in the brain involves changes in the expression of glutamate receptors

A Novel Mechanism for Cross-Adaptation between Heat and Altitude Acclimation: The Role of Heat Shock Protein 90

Contact Info

Product

Resources

About