Increased expression of the distal, but not of the proximal,Gata1 transcripts during differentiation of primary erythroid cells

Abstract

Gata1 is expressed from either one of two alternative promoters, the erythroid (proximal to the AUG) and the testis (distal to the AUG) promoter, both used by hemopoietic cells. To clarify the role of the distal and proximal Gata1 transcripts in erythroid differentiation, we determined by specific reverse transcriptase-polymerase chain reactions their relative levels of expression during the differentiation of erythroid precursors purified from the spleen of mice treated with phenylhydrazine (PHZ) or infected with the anemia-inducing strain of the Friend virus (FVA cells). PHZ cells are erythroid precursors that progress in vivo to erythroblasts in 3 days. Both PHZ and FVA cells synchronously proliferate and differentiate in vitro in the presence of erythropoietin (EPO). The levels of total and of distal, but not of proximal, Gata1 transcripts increased by five- to eightfold during in vivo and in vitro differentiation of FVA and PHZ cells. The increase in expression was temporally associated with an increase in the expression of Eklf, Scl, and Nfe2, three genes required for erythroid differentiation, and preceded by 24 h the repression of Gata2 and Myb expression. The day 1 PHZ cells that survived 18 h in the absence of EPO do not express globin genes and express detectable levels of distal but not of proximal Gata1 transcripts. These cells activate the expression of the globin genes within 2 h when exposed to EPO. Therefore, during erythroid differentiation of primary cells, increased expression of distal Gata1 transcripts underlies the increase in the expression of total Gata1 associated with the establishment of the erythroid differentiation program.

The hypomorphic Gata1low mutation alters the proliferation/differentiation potential of the common megakaryocytic-erythroid progenitor

“…The levels of Gata1 expressed by SN1 cells are higher than those expressed by normal hematopoietic cells and resemble those found in MEL cells. 41 As in the case of these erythroleukemic cells, such a high level of Gata1 expression was not sufficient per se to restore proper terminal differentiation of SN1 cells.In conclusion, BMMCs seeded with marrow (and spleen, not shown) cells from Gata1 low mice are characterized by increased proliferation and decreased cell differentiation and consistently generate 3-lineage growth factor-dependent cell lines. …”

“…The levels of Gata1 expressed by SN1 cells are higher than those expressed by normal hematopoietic cells and resemble those found in MEL cells. 41 As in the case of these erythroleukemic cells, such a high level of Gata1 expression was not sufficient per se to restore proper terminal differentiation of SN1 cells.…”

Accentuated response to phenylhydrazine and erythropoietin in mice genetically impaired for their GATA-1 expression (GATA-1low mice)

“…The expression of ␤-globin and of the total, proximal, and distal GATA-1 transcripts was analyzed by amplifying reverse-transcribed complementary DNA (cDNA) (2.5 L) in the presence of the specific sense and antisense primers (100 nM each) described elsewhere. 23 The following primers were used for the amplification of GATA-2: sense 5ЈTGCAA-CACACCACCCGAT-ACC3Ј, antisense 5ЈCAATTTGCACAACAGGTGCCC3Ј. These primers generated an expected amplification fragment of 336 base pairs.…”

“…Primers specific for ␤ 2 -microglobulin (50 nM each) were added to each amplification after the first 10 cycles as a control for the amount of cDNA used in the reaction. 23 PCR conditions were as follows: 60 seconds at 95°C, 60 seconds at 60°C, and 60 seconds at 72°C. All of the reactions The values are calculated from those presented in Table 1 and Figure 5 and from the percentages of precursor cells calculated by fluorescence-activated cell sorting and summarized in the text; the calculations take into account that the bone marrow analyzed in our experiments corresponds to 10% of all the marrow of a mouse.…”

Alternative 5′ exons and differential splicing regulate expression of protein 4.1R isoforms with distinct N-termini

“…Examples include the genes for heme biosynthetic enzymes, [40][41][42][43][44] erythroid skeletal proteins, [45][46][47] cell-surface receptors, 48 and transcription factors. [49][50][51] In many of these genes, the alternative first exons are exclusively noncoding; transcriptional regulation therefore controls spatial and temporal patterns of expression without altering protein structure. In a few cases, including the genes for erythroid ankyrin and band 3, the alternative promoters/first exons are internally located, downstream of one or more coding exons, so that their respective transcripts will encode proteins with different N-termini.…”