Inducible gene expression mediated by a repressor‐operator system isolated from <i>Lactococcus lactis</i> bacteriophage r1t

Nauta, Arjen; Sinderen, Douwe van; Karsens, Harma; Smit, Elize; Venema, Gerard; Kok, Jan

doi:10.1111/j.1365-2958.1996.tb02477.x

Cited by 95 publications

(74 citation statements)

References 47 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Sequence repeats within the promoter region have been reported to be present in L. lactis phage r1t (56) as well as Listeria monocytogenes phage A118 (44). These repeats have been shown to regulate lysogeny module gene expression in phage r1t (56). The order and orientation of the cI-and crolike repressor genes with corresponding outward facing promoters are seen in other phages, including Lactobacillus phage g1e (29), S. thermophilus phages TPJ34 and Sfi21 (10, 57), L. monocytogenes phage A118 (44), and few S. aureus phages (35).…”

Section: Resultsmentioning

confidence: 99%

First Complete Genome Sequence of TwoStaphylococcus epidermidisBacteriophages

Daniel¹,

Bonnen

Fischetti³

2007

J Bacteriol

View full text Add to dashboard Cite

Staphylococcus epidermidis is an important opportunistic pathogen causing nosocomial infections and is often associated with infections in patients with implanted prosthetic devices. A number of virulence determinants have been identified in S. epidermidis, which are typically acquired through horizontal gene transfer. Due to the high recombination potential, bacteriophages play an important role in these transfer events. Knowledge of phage genome sequences provides insights into phage-host biology and evolution. We present the complete genome sequence and a molecular characterization of two S. epidermidis phages, PH15 (PH15) and CNPH82 (CNPH82). Both phages belonged to the Siphoviridae family and produced stable lysogens. The PH15 and CNPH82 genomes displayed high sequence homology; however, our analyses also revealed important functional differences. The PH15 genome contained two introns, and in vivo splicing of phage mRNAs was demonstrated for both introns. Secondary structures for both introns were also predicted and showed high similarity to those of Streptococcus thermophilus phage 2972 introns. An additional finding was differential superinfection inhibition between the two phages that corresponded with differences in nucleotide sequence and overall gene content within the lysogeny module. We conducted phylogenetic analyses on all known Siphoviridae, which showed PH15 and CNPH82 clustering with Staphylococcus aureus, creating a novel clade within the S. aureus group and providing a higher overall resolution of the siphophage branch of the phage proteomic tree than previous studies. Until now, no S. epidermidis phage genome sequences have been reported in the literature, and thus this study represents the first complete genomic and molecular description of two S. epidermidis phages.Staphylococcus epidermidis, a member of the novobiocin-susceptible coagulase-negative staphylococci, is an important opportunistic pathogen and a major cause of nosocomial infections (42, 55). S. epidermidis predominantly colonizes the mucous membranes, groin, and axillar areas, as well as the cutaneous system of human body, with bacterial counts of up to 10 to 10 3 CFU/cm 2 (26). S. epidermidis is usually considered a harmless commensal microorganism; however, infections can occur in immunocompromised individuals and in patients with indwelling or implanted medical devices such as prosthetic heart valves and joint prostheses, where the staphylococci penetrate cutaneous and mucosal barriers (79). With the increasing use of such devices in medical practice, several million people are affected by complications arising from S. epidermidis infections (49). The widespread use of various antimicrobial agents, including penicillins, macrolides, aminoglycosides, and semisynthetic penicillins such as methicillin, has now led to the emergence of multiple-drug-resistant S. epidermidis strains (21, 72).Two S. epidermidis genomes have been sequenced: those of the non-biofilm-forming, non-infection-associated strain ATCC 12228 and the infecti...

show abstract

Section: Resultsmentioning

confidence: 99%

First Complete Genome Sequence of TwoStaphylococcus epidermidisBacteriophages

Daniel¹,

Bonnen

Fischetti³

2007

J Bacteriol

View full text Add to dashboard Cite

show abstract

“…The leaderless mRNAs identified in bacteria do not encode functionally related genes. However, it should be noted that at least four leaderless mRNAs of accessory genetic elements, two in E. coli, one in Lactococcus lactis (Walz et al, 1976, Baumeister et al, 1991, Nauta et al, 1996 and the alternative sigma factor SigE in M. tuberculosis (Donà et al, 2008), encode regulatory proteins. To ensure the latency of these genetic elements, the corresponding repressors have to be continuously synthesized, albeit at a low level.…”

mentioning

confidence: 99%

Characterization of the KstR-dependent promoter of the gene for the first step of the cholesterol degradative pathway in Mycobacterium smegmatis

et al. 2011

View full text Add to dashboard Cite

The KstR-dependent promoter of the MSMEG_5228 gene of Mycobacterium smegmatis, which encodes the 3-b-hydroxysteroid dehydrogenase (3-b HSD MS ) responsible for the first step in the cholesterol degradative pathway, has been characterized. Primer extension analysis of the P 5228 promoter showed that the transcription starts at the ATG codon, thus generating a leaderless mRNA lacking a 59 untranslated region (59UTR). Footprint analyses demonstrated experimentally that KstR specifically binds to an operator region of 31 nt containing the quasi-palindromic sequence AACTGGAACGTGTTTCAGTT, located between the "5 and "35 positions with respect to the transcription start site. This region overlaps with the "10 and "35 boxes of the P 5228 promoter, suggesting that KstR represses MSMEG_5228 transcription by preventing the binding of RNA polymerase. Using a P 5228 -b-galactosidase fusion we have demonstrated that KstR is able to work as a repressor in a heterologous system like Escherichia coli. A 3D model of the KstR protein revealed folding typical of TetR-type regulators, with two domains, i.e. a DNA-binding N-terminal domain and a regulator-binding C-terminal domain composed of six helices with a long tunnel-shaped hydrophobic pocket that might interact with a putative highly hydrophobic inducer. The finding that similar P 5228 promoter regions have been found in all mycobacterial strains examined, with the sole exception of Mycobacterium tuberculosis, provides new clues about the role of cholesterol in the pathogenicity of this micro-organism. INTRODUCTIONMycobacterium smegmatis belongs to the fast-growing nonpathogenic mycobacteria and has been widely used as a model organism to study the biology of other virulent and extremely slow-growing species like Mycobacterium tuberculosis; therefore much interest has been focused on this system for its potential use in genetic studies. Interestingly, it has been described that only fast-growing non-pathogenic mycobacteria were able to grow on cholesterol as a sole carbon source (Av-Gay & Sobouti, 2000); however, more recent results have demonstrated that cholesterol is also used as a carbon source during infection of M. tuberculosis (Pandey & Sassetti, 2008). Although recent biochemical and structural studies have assigned a role for some of the mycobacterial genes in cholesterol catabolism, the complete degradative pathway and its specific regulation remain to be fully established (Capyk et al., 2009;Knol et al., 2008;Lack et al., 2010;Yam et al., 2009). Recently, it has been shown that cholesterol utilization in mycobacteria is controlled by two TetR-type transcriptional repressors (Kendall et al., 2007(Kendall et al., , 2010. One of these repressors, named KstR, is encoded by the Rv3574 gene in M. tuberculosis and by the MSMEG_6042 gene in M. smegmatis. KstR controls the expression of 83 cholesterol catabolic genes (kstR regulon) (Kendall et al., 2007); many of these genes are essential for virulence, highlighting the importance of cholesterol catabolism in the pathogenici...

show abstract

“…The regulatory region of bacteriophage rl t consists of two divergently oriented genes, rro and tec Nautaet al, 1996;see Figure 8 Nauta et al (1996).…”

Section: Bacteriophagesmentioning

confidence: 99%

Inducible gene expression and environmentally regulated genes in lactic acid bacteria

Kok

1996

Antonie van Leeuwenhoek

Self Cite

View full text Add to dashboard Cite

Link to publication in University of Groningen/UMCG research database Citation for published version (APA): . Inducible gene expression and environmentally regulated genes in lactic acid bacteria. Antonie Van Leeuwenhoek: International Journal of General and Molecular Microbiology, 70(2-4), 129-145. https://doi.org/10.1007/BF00395930 Copyright Other than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of the author(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).Take-down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons the number of authors shown on this cover page is limited to 10 maximum. SummaryRelatively recently, a number of genes and operons have been identified in lactic acid bacteria that are inducible and respond to environmental factors. Some of these genes/operons had been isolated and analysed because of their importance in the fermentation industry and, consequently, their transcription was studied and found to be regulatable. Examples are the lactose operon, the operon for nisin production, and genes in the proteolytic pathway ofLactococcus lactis, as well as xylose metabolism in Lactobacilluspentosus. Some other operons were specifically targetted with the aim to compare their mode of regulation with known regulatory mechanisms in other well-studied bacteria. These studies, dealing with the biosynthesis of histidine, tryptophan, and of the branched chain amino acids in L. lactis, have given new insights in gene regulation and in the occurrence of auxotrophy in these bacteria. Also, nucleotide sequence analyses of a number of lactococcal bacteriophages was recently initiated to, among other things, specifically learn more about regulation of the phage life cycle. Yet another approach in the analysis of regulated genes is the 'random' selection of genetic elements that respond to environmental stimuli and the first of such sequences from lactic acid bacteria have been identified and characterized. The potential of these regulatory elements in fundamental research and practical (industrial) applications will be discussed.

show abstract

Inducible gene expression mediated by a repressor‐operator system isolated from Lactococcus lactis bacteriophage r1t

Cited by 95 publications

References 47 publications

First Complete Genome Sequence of TwoStaphylococcus epidermidisBacteriophages

First Complete Genome Sequence of TwoStaphylococcus epidermidisBacteriophages

Characterization of the KstR-dependent promoter of the gene for the first step of the cholesterol degradative pathway in Mycobacterium smegmatis

Inducible gene expression and environmentally regulated genes in lactic acid bacteria

Contact Info

Product

Resources

About