Inducible Loss of the Aryl Hydrocarbon Receptor Activates Perigonadal White Fat Respiration and Brown Fat Thermogenesis via Fibroblast Growth Factor 21

Abstract

The aryl hydrocarbon receptor (AHR) is a ligand-activated transcription factor highly expressed in hepatocytes. Researchers have employed global and liver-specific conditional Ahr knockout mouse models to characterize the physiological roles of the AHR; however, the gestational timing of AHR loss in these models can complicate efforts to distinguish the direct and indirect effects of post-gestational AHR deficiency. Utilizing a novel tamoxifen-inducible AHR knockout mouse model, we analyzed the effects of hepatocyte-targeted AHR loss in adult mice. The data demonstrate that AHR deficiency significantly reduces weight gain and adiposity, and increases multilocular lipid droplet formation within perigonadal white adipose tissue (gWAT). Protein and mRNA expression of fibroblast growth factor 21 (FGF21), an important hepatokine that activates thermogenesis in brown adipose tissue (BAT) and gWAT, significantly increases upon AHR loss and correlates with a significant increase of BAT and gWAT respiratory capacity. Confirming the role of FGF21 in mediating these effects, this phenotype is reversed in mice concomitantly lacking AHR and FGF21 expression. Chromatin immunoprecipitation analyses suggest that the AHR may constitutively suppress Fgf21 transcription through binding to a newly identified xenobiotic response element within the Fgf21 promoter. The data demonstrate an important AHR-FGF21 regulatory axis that influences adipose biology and may represent a “druggable” therapeutic target for obesity and its related metabolic disorders.

Association of aryl hydrocarbon receptor (AhR) serum level and gene rs10247158 polymorphism with anthropometric, biochemical parameters and food consumption in overweight/obese patients

“…In that study, mice with high affinity for AhR were found to be more prone to obesity compared with those with low AhR affinity 9 . Other studies indicate that the AhR expression or loss of function reduces body weight and protects against problems related to a high‐fat diet 9,10,29‐32 . A recent study found significantly higher AhR and CYP1B1 gene expression in obese children compared with those with normal body weight.…”

Relationship between FGF21 and drug or nondrug therapy of type 2 diabetes mellitus

“…In addition, the level of circulating FGF21 also increased when the protein content in the diet was low. Studies have shown that reducing protein content in diet from 25% to 10% for 4 consecutive days can increase circulating FGF21 levels by about six times (Gosby et al, 2016). Laeger et al (2014) also showed that FGF21 increased during a low protein (5% dietary protein) diet in mice and humans, even when the total energy is fixed (Bray et al, 2012).…”

“…Stress stimulation or electrical stimulation of muscle movements caused by exercise can stimulate the phosphorylation of Akt (Ito et al, 2006; Sakamoto, Arnolds, Ekberg, Thorell, & Goodyear, 2004; Sakamoto, Aschenbach, Hirshman, & Goodyear, 2003), thus participating in the regulation of FGF21 expression. In addition, the aryl hydrocarbon receptor can constructively inhibit the transcription of FGF21 by binding to a newly identified exogenous response element in the FGF21 promoter (Girer et al, 2019). As previously mentioned, the genes related to the major signaling pathways of ER stress, such as X‐box‐binding protein 1, ATF4, and transcription factor C/EBP homologous protein, are also important activators of FGF21 transcription (Grandini, da Rocha Barros, & Navarro, 1989; Jiang et al, 2014; Montgomery et al, 2018).…”

Liver-Specific Nonviral Gene Delivery of Fibroblast Growth Factor 21 Protein Expression in Mice Regulates Body Mass and White/Brown Fat Respiration

“…Forward: 5′ ACGGCAAATTCAACGGCACAGTCA 3′, Reverse: 5′ CATTGGGGGTAGGAACACGGAAGG 3′. Protein analyses were conducted as previously described (Girer et al, 2019) Quantification of protein expression, normalized to Actin, was performed using ImageJ software (Schneider et al, 2012).…”